[Home] | [Total List]

[172142_x_at]

Description R05D3.5 /REP_DB=WormBase Gene ID /WP=CE25967 /GB=AAK21445.1 /SUBMIT=ST.LOUIS /CHR=3 /FEA=Sanger Annotation
Cluster 6grp_total > 94      4grp_total > 03      6grp_total_sub > Hat      4grp_rule_based > L4      

Scale

Warning: fopen(./gnuplot/172142_x_at_1_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/172142_x_at_1_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/172142_x_at_2_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/172142_x_at_2_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 282
1 2 3 4 range
A 44.8
(-2.3)
A
77.1
(-1.6)
A
13.4
(-3)
A
295
(3)
A
282
B 68.4
(0.9)
A
46.1
(-2.9)
A
45.4
(-3)
A
80.7
(3)
A
35
C 57.8
(-2.1)
A
25.3
(-3)
A
36
(-2.7)
A
239.8
(3)
P
215
avr 57
(-2.1)
49.5
(-2.4)
31.6
(-3)
205.2
(3)
174

Warning: fopen(./gnuplot/172142_x_at_dSignal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/172142_x_at_dSignal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 138
1 2 3 4 5 6 range
A 12.4
(-3)
A
52.6
(-1)
A
93.2
(1)
P
50.8
(-1.1)
A
102
(1.5)
P
132.5
(3)
P
120
B 37.6
(-1.9)
A
67.9
(-0.6)
A
12.1
(-3)
A
66.5
(-0.6)
A
150.5
(3)
P
92.6
(0.5)
P
138
C 27.8
(-3)
A
96.8
(1.5)
A
67.5
(-0.4)
A
52.8
(-1.4)
A
119.1
(3)
P
57.8
(-1)
P
91
avr 25.9
(-3)
72.4
(-0.2)
57.6
(-1.1)
56.7
(-1.1)
123.9
(3)
94.3
(1.2)
98
No Scale

Warning: fopen(./gnuplot/172142_x_at_1_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/172142_x_at_1_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/172142_x_at_2_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/172142_x_at_2_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 40
1 2 3 4 range
A 16.3
(-1.1)
A
16.7
(-1)
A
3.5
(-3)
A
43.2
(3)
A
40
B 21.8
(3)
A
11.4
(-2.5)
A
10.5
(-3)
A
17.2
(0.6)
A
11
C 19.1
(-0.9)
A
7.3
(-3)
A
12.6
(-2)
A
40.4
(3)
P
33
avr 19.1
(-0.5)
11.8
(-2.3)
8.9
(-3)
33.6
(3)
25

Warning: fopen(./gnuplot/172142_x_at_dNo_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/172142_x_at_dNo_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 59
1 2 3 4 5 6 range
A 2.3
(-3)
A
18.7
(0.3)
A
20.3
(0.6)
P
12.9
(-0.9)
A
30.8
(2.7)
P
32.3
(3)
P
30
B 13.1
(-1.9)
A
22.6
(-1)
A
2.9
(-3)
A
17.6
(-1.5)
A
61.1
(3)
P
34.5
(0.3)
P
58
C 10.3
(-3)
A
29.5
(1.1)
A
17.2
(-1.5)
A
10.6
(-2.9)
A
38.5
(3)
P
19.4
(-1.1)
P
28
avr 8.6
(-3)
23.6
(-0.4)
13.5
(-2.2)
13.7
(-2.1)
43.5
(3)
28.7
(0.5)
35
NetAffx Links Cluster Members
Consensus/Exemplar
Group Members
GeneChip Array Information
Probe Set ID 172142_x_at
GeneChip Array C. elegans Genome Array
Organism Common Name Nematode
Probe Design Information
Transcript ID(Array Design) affy.Ce.6547
Sequence Type Exemplar sequence
Representative Public ID R05D3.5 NCBI
Target Description R05D3.5 /REP_DB=WormBase Gene ID /WP=CE25967 /GB=AAK21445.1 /SUBMIT=ST.LOUIS /CHR=3 /FEA=Sanger Annotation
Annotation Method Description
Annotation Description This probe set was annotated using the Genome Target Overlap based pipeline to a RefSeq identifier using 1 transcript(s).
Annotation Grade This is a grade B annotation.
Annotation Transcript Cluster (# of Matching Probes) NM_066437, NM_069841, NM_066439
Transcript Assignments
Representative
Transcript
Description Matching Probes Related Probesets by Grade
SNAP00000039719 ENSEMBL cdna:SNAP chromosome:CEL140:III:8340841:8341658:1 None
NM_066439 NCBI Caenorhabditis elegans R05D3.5 (R05D3.5) mRNA, complete cds. None
F38H4.6 ENSEMBL cdna:known chromosome:CEL140:IV:11847005:11848115:-1 gene:F38H4.6 A 
NM_069841 NCBI Caenorhabditis elegans F38H4.6 (F38H4.6) mRNA, complete cds. A 
SNAP00000007678 ENSEMBL cdna:SNAP chromosome:CEL140:IV:11847005:11847727:-1 None
GENEFINDER00000007688 ENSEMBL cdna:GeneFinder chromosome:CEL140:IV:11847005:11847727:-1 None
NM_066437 NCBI Caenorhabditis elegans ZC262.1 (ZC262.1) mRNA, complete cds. None
ZC262.1 ENSEMBL cdna:known chromosome:CEL140:III:8340841:8341325:1 gene:ZC262.1 None
SNAP00000035973 ENSEMBL cdna:SNAP chromosome:CEL140:III:8349036:8349853:1 None
R05D3.5 ENSEMBL cdna:known chromosome:CEL140:III:8349036:8349520:1 gene:R05D3.5 None
SNAP00000039719 ENSEMBL cdna:SNAP chromosome:CEL140:III:8340841:8341658:1 None
NM_066439 NCBI Caenorhabditis elegans R05D3.5 (R05D3.5) mRNA, complete cds. None
NM_069841 NCBI Caenorhabditis elegans F38H4.6 (F38H4.6) mRNA, complete cds. A 
F38H4.6 ENSEMBL cdna:known chromosome:CEL140:IV:11847005:11848115:-1 gene:F38H4.6 A 
SNAP00000007678 ENSEMBL cdna:SNAP chromosome:CEL140:IV:11847005:11847727:-1 None
GENEFINDER00000007688 ENSEMBL cdna:GeneFinder chromosome:CEL140:IV:11847005:11847727:-1 None
NM_066437 NCBI Caenorhabditis elegans ZC262.1 (ZC262.1) mRNA, complete cds. None
ZC262.1 ENSEMBL cdna:known chromosome:CEL140:III:8340841:8341325:1 gene:ZC262.1 None
SNAP00000035973 ENSEMBL cdna:SNAP chromosome:CEL140:III:8349036:8349853:1 None
R05D3.5 ENSEMBL cdna:known chromosome:CEL140:III:8349036:8349520:1 gene:R05D3.5 None
Annotation Notes
There are no noteworthy cross hybridizing mRNAs found for this probe set.
Genomic Alignment of Consensus/Exemplar Sequence
Assembly Wormbase March 2004
Alignment(s)
Position Identity Coverage Cytoband
chrIII:8349031-8349849(+) 100.0 100.0
chrIII:8340836-8341654(+) 100.0 100.0
Public Domain and Genome References
Gene Title


Ensembl ZC262.1
R05D3.5
F38H4.6
Entrez Gene 176177 Entrez gene
185481 Entrez gene
191129 Entrez gene
SwissProt Q20185 EMBL-EBI
P34538 EMBL-EBI
P34593 EMBL-EBI
WormBase CE10068 Wormbase
CE28272 Wormbase
CE28272 Wormbase
Functional Annotations
Gene Ontology
GO Molecular Function (view graph)
ID Description Evidence Links
5198 structural molecule activity inferred from electronic annotation QuickGO AmiGO
Protein Similarities
Method ID Description E-Value
blast CAB01177 Hypothetical protein F38H4.6 [Caenorhabditis elegans] ref|NP_502242.1| F38H4.6 [Caenorhabditis elegans] 1.0E-110
blast CAB01177 Hypothetical protein F38H4.6 [Caenorhabditis elegans] ref|NP_502242.1| F38H4.6 [Caenorhabditis elegans] 2.0E-86
blast P34538 Hypothetical protein R05D3.5 in chromosome III 2.0E-76
blast P34538 Hypothetical protein R05D3.5 in chromosome III 3.0E-76
blast P34538 Hypothetical protein R05D3.5 in chromosome III 6.0E-76
Protein Domains
Database ID Description E-Value
Pfam IPR000535 EMBL-EBI Major sperm protein (MSP) domain 8.7E-26
Pfam IPR000535 EMBL-EBI Major sperm protein (MSP) domain 1.9E-27
Pfam IPR000535 EMBL-EBI Major sperm protein (MSP) domain 8.7E-26
Sequence
Target Sequence
>C. ELEGANS:172142_X_AT
atcaccggttgctgttggtatgacggttcttccaccaaatcaagaaaattttgttgatgc
tggatcaactacattgatgaataaacccggtgaaccgattttcaaattggccattaatct
gacaaaaaagcaagcggctaacaggcatgtaggcaggcgtaaatcaagaacgaactttaa
aaacacattttcaacagttgaattcaagtgcacagaagatcgaaaaccaatatcagtaaa
cttgaagttgcacaatccaacggctgtaactgtttcgtacaaagttcgttgcacgtctgc
agatatttttcgtgtccaacctccactgggatttgtaaagccgagtgaaacagtttcaat
tgtgatttggtatcagaatcaagacaagaaagatgcaatctcaaagaatcactatttcgc
tttttaccataccaacagcgatggaagaactgctcgtgaattatgggc


BLASTn GenBank NR
Probe Info
Probe Sequence(5'-3') Probe X Probe Y Probe Interrogation
Position
Strandedness
ATCACCGGTTGCTGTTGGTATGACG 471 27 27 Antisense
TATGACGGTTCTTCCACCAAATCAA 477 655 45 Antisense
GAACCGATTTTCAAATTGGCCATTA 250 347 118 Antisense
GCAAGCGGCTAACAGGCATGTAGGC 117 313 156 Antisense
GGCATGTAGGCAGGCGTAAATCAAG 606 535 170 Antisense
GCACAATCCAACGGCTGTAACTGTT 93 317 276 Antisense
GTACAAAGTTCGTTGCACGTCTGCA 424 461 303 Antisense
TGCAGATATTTTTCGTGTCCAACCT 573 577 324 Antisense
TGTCCAACCTCCACTGGGATTTGTA 45 557 339 Antisense
TATTTCGCTTTTTACCATACCAACA 210 663 439 Antisense
GAAGAACTGCTCGTGAATTATGGGC 136 341 470 Antisense
Sequence Source Affymetrix Proprietary Database