[Home] | [Total List]

[172133_x_at]

Description F59D8.A /REP_DB=WormBase Gene ID /WP=CE20900 /CHR=X /FEA=Sanger Annotation /DEF=(ST.LOUIS) protein_id:AAF35966.1
Cluster 6grp_total > 99      4grp_total > 25      6grp_cgc > 79      6grp_cgc_sub > Da      6grp_total_sub > Increase      6grp_rule_based > S5      4grp_rule_based > L4      

Scale

Warning: fopen(./gnuplot/172133_x_at_1_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/172133_x_at_1_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/172133_x_at_2_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/172133_x_at_2_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 172
1 2 3 4 range
A 34.9
(-3)
A
75.9
(-1.4)
A
132.7
(0.9)
A
186
(3)
A
151
B 56
(-3)
A
130.3
(2.3)
A
94.3
(-0.3)
A
140.6
(3)
A
85
C 56.4
(-3)
A
110.2
(-0.8)
A
108.6
(-0.9)
A
206.5
(3)
A
150
avr 49.1
(-3)
105.5
(-0.4)
111.9
(-0.1)
177.7
(3)
129

Warning: fopen(./gnuplot/172133_x_at_dSignal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/172133_x_at_dSignal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 6994
1 2 3 4 5 6 range
A 89.3
(-2.9)
A
80.6
(-2.9)
A
14.9
(-3)
A
95.5
(-2.9)
A
6769.1
(3)
P
5062.2
(1.5)
P
6754
B 80.1
(-2.9)
A
43.1
(-3)
A
16.4
(-3)
A
59.8
(-2.9)
A
4974.8
(2.8)
P
5155.1
(3)
P
5139
C 62.3
(-3)
A
69.5
(-3)
A
62
(-3)
A
26.8
(-3)
A
7008.6
(3)
P
4784.7
(1.1)
P
6982
avr 77.2
(-3)
64.4
(-3)
31.1
(-3)
60.7
(-3)
6250.8
(3)
5000.7
(1.8)
6220
No Scale

Warning: fopen(./gnuplot/172133_x_at_1_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/172133_x_at_1_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/172133_x_at_2_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/172133_x_at_2_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 25
1 2 3 4 range
A 12.7
(-3)
A
16.5
(-2)
A
34.7
(3)
A
27.2
(1)
A
22
B 17.9
(-3)
A
32.2
(3)
A
21.9
(-1.3)
A
30
(2.1)
A
14
C 18.7
(-3)
A
31.7
(1.1)
A
37.9
(3)
A
34.8
(2)
A
19
avr 16.4
(-3)
26.8
(1.1)
31.5
(3)
30.7
(2.7)
15

Warning: fopen(./gnuplot/172133_x_at_dNo_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/172133_x_at_dNo_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 2265
1 2 3 4 5 6 range
A 16.5
(-3)
A
28.7
(-2.9)
A
3.2
(-3)
A
24.2
(-2.9)
A
2042.6
(3)
P
1232.5
(0.6)
P
2039
B 27.9
(-2.9)
A
14.3
(-3)
A
4
(-3)
A
15.8
(-3)
A
2021.2
(3)
P
1922.3
(2.7)
P
2017
C 23.1
(-3)
A
21.2
(-3)
A
15.8
(-3)
A
5.4
(-3)
A
2267.9
(3)
P
1601.7
(1.2)
P
2263
avr 22.5
(-3)
21.4
(-3)
7.7
(-3)
15.1
(-3)
2110.6
(3)
1585.5
(1.5)
2103
NetAffx Links Cluster Members
Consensus/Exemplar
Group Members
GeneChip Array Information
Probe Set ID 172133_x_at
GeneChip Array C. elegans Genome Array
Organism Common Name Nematode
Probe Design Information
Transcript ID(Array Design) affy.Ce.19606
Sequence Type Exemplar sequence
Representative Public ID F59D8.A NCBI
Target Description F59D8.A /REP_DB=WormBase Gene ID /WP=CE20900 /CHR=X /FEA=Sanger Annotation /DEF=(ST.LOUIS) protein_id:AAF35966.1
Cluster Evidence This cluster is supported by a Sanger Annotation.
Annotation Method Description
Annotation Description This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s).
Annotation Grade This is a grade A annotation.
Annotation Transcript Cluster (# of Matching Probes) NM_076212(11)
Transcript Assignments
Representative
Transcript
Description Matching Probes Related Probesets by Grade
NM_076212 NCBI Caenorhabditis elegans VITellogenin structural genes (yolk protein genes) family member (vit-3) (vit-3) mRNA, complete cds. 11/11 A 
SNAP00000016179 ENSEMBL cdna:SNAP chromosome:CEL140:X:3567445:3572527:-1 11/11 None
GENEFINDER00000016190 ENSEMBL cdna:GeneFinder chromosome:CEL140:X:3567531:3572587:-1 10/11 None
F59D8.1.2 ENSEMBL cdna:known chromosome:CEL140:X:3567155:3572527:-1 gene:F59D8.1 11/11 A 
F59D8.1.1 ENSEMBL cdna:known chromosome:CEL140:X:3567155:3572527:-1 gene:F59D8.1 11/11 A 
F59D8.1.3 ENSEMBL cdna:known chromosome:CEL140:X:3567396:3572527:-1 gene:F59D8.1 11/11 None
Annotation Notes
Cross Hybridizing mRNA Matched Probes Nature of Assignment Related Probesets by Grade
NM_076211 6/11 Cross Hyb Matching Probes A 
NM_076188 6/11 Cross Hyb Matching Probes A 
GENEFINDER00000029426 6/11 Cross Hyb Matching Probes None
SNAP00000029419 6/11 Cross Hyb Matching Probes None
SNAP00000036909 6/11 Cross Hyb Matching Probes None
GENEFINDER00000036913 6/11 Cross Hyb Matching Probes None
C04F6.1 6/11 Cross Hyb Matching Probes A 
F59D8.2 6/11 Cross Hyb Matching Probes A 
Genomic Alignment of Consensus/Exemplar Sequence
Assembly Wormbase March 2004
Alignment(s)
Position Identity Coverage Cytoband
chrX:3403468-3408542(+) 97.57 97.57
chrX:3567445-3572528(-) 100.0 100.0
chrX:3558880-3563953(-) 98.92 98.92
Public Domain and Genome References
Gene Title
Gene Symbol vit-3
Ensembl F59D8.1
Entrez Gene 180647 Entrez gene
SwissProt Q9N4J2 EMBL-EBI
WormBase CE20900 Wormbase
Functional Annotations
Ortholog
ID Title Organism
CHICKEN:GGA.4125.1.S1_AT vitellogenin I gga
HG-U133_PLUS_2:239061_AT tetra-peptide repeat homeobox-like hs
HG-U133B:239061_AT tetra-peptide repeat homeobox-like hs
U133_X3P:HS.216699.0.A1_3P_AT tetra-peptide repeat homeobox-like hs
HG-U95E:71466_AT tetra-peptide repeat homeobox-like hs
Gene Ontology
GO Biological Process (view graph)
ID Description Evidence Links
6869 lipid transport inferred from electronic annotation QuickGO AmiGO
GO Molecular Function (view graph)
ID Description Evidence Links
5319 lipid transporter activity inferred from electronic annotation QuickGO AmiGO
Protein Similarities
Method ID Description E-Value
blast AAK09075 Vitellogenin structural genes (yolk protein genes) protein 3 [Caenorhabditis elegans] ref|NP_508613.1| VITellogenin structural genes (yolk protein genes) family member (vit-3) [Caenorhabditis elegans] sp|Q9N4J2|VIT3_CAEEL Vitellogenin 3 precursor 0.0
blast AAK09074 Vitellogenin structural genes (yolk protein genes) protein 4 [Caenorhabditis elegans] ref|NP_508612.1| VITellogenin structural genes (yolk protein genes) family member (vit-4) [Caenorhabditis elegans] sp|P18947|VIT4_CAEEL Vitellogenin 4 precursor 0.0
blast AAA83587 Vitellogenin structural genes (yolk protein genes) protein 5 [Caenorhabditis elegans] ref|NP_508589.1| VITellogenin structural genes (yolk protein genes) family member (vit-5) [Caenorhabditis elegans] 0.0
Protein Domains
Database ID Description E-Value
Pfam IPR001846 EMBL-EBI von Willebrand factor, type D 1.2E-40
Pfam IPR001747 EMBL-EBI Lipid transport protein, N-terminal 1.0E-126
Pfam IPR001846 EMBL-EBI von Willebrand factor, type D 1.2E-40
Pfam IPR001747 EMBL-EBI Lipid transport protein, N-terminal 1.0E-126
Trans Membrane
ID Number Of Domains Domain Boundaries
GENEFINDER00000016190 1 13-35
Sequence
Target Sequence
>C. ELEGANS:172133_X_AT
accttattgttattcgtcttccacatggagaggttcgtttcgatggatacactgtcaaga
ccaacatgccatccgttgcttcacaaaaccaactttgcggactttgcggaaacaatgacg
gtgagagagacaatgagttcatgaccgctgacaactacgaaactgaggatgttgaggaat
tccaccgctcttaccttctcaagaacgaagaatgcgaagttgagaacgaccgcatctccg
agaagaagaactacagaaacaaatggaacagagaagagaagaagtccgactacgtgagca
gctccgactatgagaacaactacgatgaaaaggaaactgagaaccaacttttcaagaaga
ccctcatcaaggagttctccaaccgcgtctgcttctccatcgagccagtctctgagtgcc
gccgtggactcgaatccgagaagacttccaacgagaagatccgtttcacttgcatgccac
gccacagcaagaacgcccgccgtttcttgaaggaggctcgtgagcaaactgttgccgatt
tggtcgatttcccagtc


BLASTn GenBank NR
Probe Info
Probe Sequence(5'-3') Probe X Probe Y Probe Interrogation
Position
Strandedness
ACCTTATTGTTATTCGTCTTCCACA 565 87 4220 Antisense
GGTTCGTTTCGATGGATACACTGTC 611 503 4251 Antisense
AAGACCAACATGCCATCCGTTGCTT 690 153 4276 Antisense
GTTCATGACCGCTGACAACTACGAA 61 445 4356 Antisense
GGATGTTGAGGAATTCCACCGCTCT 303 513 4386 Antisense
TTGAGAACGACCGCATCTCCGAGAA 112 683 4439 Antisense
AGAAGTCCGACTACGTGAGCAGCTC 350 75 4499 Antisense
GACCCTCATCAAGGAGTTCTCCAAC 41 383 4578 Antisense
GAGAAGATCCGTTTCACTTGCATGC 39 393 4672 Antisense
GCCCGCCGTTTCTTGAAGGAGGCTC 144 285 4714 Antisense
TGCCGATTTGGTCGATTTCCCAGTC 398 585 4752 Antisense
Sequence Source Affymetrix Proprietary Database