[Home] | [Total List]

[172113_x_at]

Description Y59H11AM.D /REP_DB=WormBase Gene ID /WP=CE25520 /CHR=4 /FEA=Sanger Annotation /DEF=(ST.LOUIS)
Cluster 6grp_total > 98      4grp_total > 02      6grp_total_sub > Increase      6grp_rule_based > S6      4grp_rule_based > L4      

Scale

Warning: fopen(./gnuplot/172113_x_at_1_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/172113_x_at_1_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/172113_x_at_2_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/172113_x_at_2_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 375
1 2 3 4 range
A 88.4
(-3)
A
96.2
(-2.9)
A
104.4
(-2.7)
A
442.7
(3)
A
354
B 98.8
(-3)
A
135.3
(0.3)
A
122.8
(-0.9)
A
165.9
(3)
A
67
C 153.9
(-1.6)
A
117.9
(-2.2)
A
67.5
(-3)
A
438.6
(3)
A
371
avr 113.7
(-2.6)
116.5
(-2.6)
98.2
(-3)
349.1
(3)
251

Warning: fopen(./gnuplot/172113_x_at_dSignal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/172113_x_at_dSignal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 15008
1 2 3 4 5 6 range
A 91.4
(-3)
A
92.8
(-3)
A
188.5
(-3)
A
1015.2
(-2.6)
P
5430.3
(-0.9)
P
15027.2
(3)
P
14936
B 86.8
(-3)
A
150
(-2.9)
A
115.1
(-3)
A
797.9
(-2.4)
P
5416.3
(1.4)
P
7414.1
(3)
P
7327
C 19
(-3)
A
283.4
(-2.8)
A
78.8
(-3)
A
653.4
(-2.6)
A
10122.7
(3)
P
7838.2
(1.6)
P
10104
avr 65.7
(-3)
175.4
(-2.9)
127.5
(-3)
822.2
(-2.5)
6989.8
(1.1)
10093.2
(3)
10028
No Scale

Warning: fopen(./gnuplot/172113_x_at_1_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/172113_x_at_1_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/172113_x_at_2_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/172113_x_at_2_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 53
1 2 3 4 range
A 32.2
(-1.5)
A
20.9
(-3)
A
27.3
(-2.1)
A
64.8
(3)
A
44
B 31.5
(-0.3)
A
33.4
(1.3)
A
28.4
(-3)
A
35.3
(3)
A
7
C 50.9
(0.3)
A
33.9
(-1.8)
A
23.5
(-3)
A
74
(3)
A
51
avr 38.2
(-0.8)
29.4
(-2.4)
26.4
(-3)
58
(3)
32

Warning: fopen(./gnuplot/172113_x_at_dNo_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/172113_x_at_dNo_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 3652
1 2 3 4 5 6 range
A 16.9
(-3)
A
33
(-3)
A
41.1
(-3)
A
257.5
(-2.6)
P
1638.6
(-0.3)
P
3658.6
(3)
P
3642
B 30.2
(-3)
A
49.9
(-3)
A
27.9
(-3)
A
211.3
(-2.6)
P
2200.6
(1.8)
P
2764.7
(3)
P
2737
C 7
(-3)
A
86.5
(-2.9)
A
20.1
(-3)
A
131.4
(-2.8)
A
3275.5
(3)
P
2623.9
(1.8)
P
3269
avr 18
(-3)
56.5
(-2.9)
29.7
(-3)
200.1
(-2.6)
2371.6
(1.7)
3015.7
(3)
2998
NetAffx Links Cluster Members
Consensus/Exemplar
Group Members
GeneChip Array Information
Probe Set ID 172113_x_at
GeneChip Array C. elegans Genome Array
Organism Common Name Nematode
Probe Design Information
Transcript ID(Array Design) affy.Ce.19100
Sequence Type Exemplar sequence
Representative Public ID Y59H11AM.D NCBI
Target Description Y59H11AM.D /REP_DB=WormBase Gene ID /WP=CE25520 /CHR=4 /FEA=Sanger Annotation /DEF=(ST.LOUIS)
Cluster Evidence This cluster is supported by a Sanger Annotation.
Annotation Method Description
Annotation Description This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s).
Annotation Grade This is a grade A annotation.
Annotation Transcript Cluster (# of Matching Probes) NM_069063(11)
Transcript Assignments
Representative
Transcript
Description Matching Probes Related Probesets by Grade
NM_069063 NCBI Caenorhabditis elegans Y59H11AM.1 (Y59H11AM.1) mRNA, complete cds. 11/11 None
SNAP00000029847 ENSEMBL cdna:SNAP chromosome:CEL140:IV:8571420:8571803:1 11/11 None
GENEFINDER00000029849 ENSEMBL cdna:GeneFinder chromosome:CEL140:IV:8571420:8571803:1 11/11 None
Y59H11AM.1 ENSEMBL cdna:known chromosome:CEL140:IV:8571420:8571803:1 gene:Y59H11AM.1 11/11 None
Annotation Notes
Cross Hybridizing mRNA Matched Probes Nature of Assignment Related Probesets by Grade
NM_069433 1/11 Cross Hyb Matching Probes A 
NM_062497 2/11 Cross Hyb Matching Probes A 
NM_068370 4/11 Cross Hyb Matching Probes A 
NM_069448 1/11 Cross Hyb Matching Probes A 
NM_068310 5/11 Cross Hyb Matching Probes A 
NM_068312 4/11 Cross Hyb Matching Probes A 
NM_068313 3/11 Cross Hyb Matching Probes A 
NM_062558 1/11 Cross Hyb Matching Probes A 
NM_062569 1/11 Cross Hyb Matching Probes A 
NM_062571 1/11 Cross Hyb Matching Probes A 
NM_068351 3/11 Cross Hyb Matching Probes A 
NM_068354 3/11 Cross Hyb Matching Probes A 
NM_068359 3/11 Cross Hyb Matching Probes A 
NM_068377 4/11 Cross Hyb Matching Probes A 
NM_068379 3/11 Cross Hyb Matching Probes A 
NM_062490 1/11 Cross Hyb Matching Probes A 
NM_069339 1/11 Cross Hyb Matching Probes A 
NM_069358 1/11 Cross Hyb Matching Probes A 
NM_069359 1/11 Cross Hyb Matching Probes A 
NM_069361 1/11 Cross Hyb Matching Probes A 
NM_069380 1/11 Cross Hyb Matching Probes A 
NM_062457 1/11 Cross Hyb Matching Probes A 
NM_062464 1/11 Cross Hyb Matching Probes A 
NM_068372 5/11 Cross Hyb Matching Probes A 
SNAP00000000807 1/11 Cross Hyb Matching Probes None
GENEFINDER00000000821 1/11 Cross Hyb Matching Probes None
SNAP00000016470 1/11 Cross Hyb Matching Probes None
GENEFINDER00000016484 1/11 Cross Hyb Matching Probes None
SNAP00000019951 1/11 Cross Hyb Matching Probes None
GENEFINDER00000019958 1/11 Cross Hyb Matching Probes None
SNAP00000021327 1/11 Cross Hyb Matching Probes None
SNAP00000021329 1/11 Cross Hyb Matching Probes None
GENEFINDER00000021346 1/11 Cross Hyb Matching Probes None
GENEFINDER00000021348 1/11 Cross Hyb Matching Probes None
SNAP00000043869 1/11 Cross Hyb Matching Probes None
SNAP00000043876 2/11 Cross Hyb Matching Probes None
GENEFINDER00000043883 1/11 Cross Hyb Matching Probes None
SNAP00000002639 3/11 Cross Hyb Matching Probes None
SNAP00000002641 2/11 Cross Hyb Matching Probes None
GENEFINDER00000002656 2/11 Cross Hyb Matching Probes None
GENEFINDER00000002661 3/11 Cross Hyb Matching Probes None
SNAP00000004243 1/11 Cross Hyb Matching Probes None
SNAP00000004244 1/11 Cross Hyb Matching Probes None
SNAP00000004246 1/11 Cross Hyb Matching Probes None
GENEFINDER00000004263 1/11 Cross Hyb Matching Probes None
GENEFINDER00000004265 1/11 Cross Hyb Matching Probes None
GENEFINDER00000004273 1/11 Cross Hyb Matching Probes None
SNAP00000005864 1/11 Cross Hyb Matching Probes None
GENEFINDER00000005869 1/11 Cross Hyb Matching Probes None
SNAP00000006004 4/11 Cross Hyb Matching Probes None
SNAP00000006006 5/11 Cross Hyb Matching Probes None
SNAP00000006011 2/11 Cross Hyb Matching Probes None
SNAP00000006013 4/11 Cross Hyb Matching Probes None
SNAP00000006015 3/11 Cross Hyb Matching Probes None
GENEFINDER00000006018 2/11 Cross Hyb Matching Probes None
GENEFINDER00000006020 4/11 Cross Hyb Matching Probes None
GENEFINDER00000006021 4/11 Cross Hyb Matching Probes None
GENEFINDER00000006023 5/11 Cross Hyb Matching Probes None
GENEFINDER00000006024 3/11 Cross Hyb Matching Probes None
SNAP00000007231 5/11 Cross Hyb Matching Probes None
GENEFINDER00000007236 5/11 Cross Hyb Matching Probes None
SNAP00000029404 4/11 Cross Hyb Matching Probes None
SNAP00000029405 3/11 Cross Hyb Matching Probes None
GENEFINDER00000029413 4/11 Cross Hyb Matching Probes None
GENEFINDER00000029416 3/11 Cross Hyb Matching Probes None
SNAP00000034129 3/11 Cross Hyb Matching Probes None
SNAP00000034134 3/11 Cross Hyb Matching Probes None
GENEFINDER00000034137 3/11 Cross Hyb Matching Probes None
GENEFINDER00000034140 3/11 Cross Hyb Matching Probes None
SNAP00000040134 1/11 Cross Hyb Matching Probes None
GENEFINDER00000040145 1/11 Cross Hyb Matching Probes None
SNAP00000041533 1/11 Cross Hyb Matching Probes None
GENEFINDER00000041543 1/11 Cross Hyb Matching Probes None
SNAP00000043472 1/11 Cross Hyb Matching Probes None
GENEFINDER00000043484 1/11 Cross Hyb Matching Probes None
SNAP00000043994 5/11 Cross Hyb Matching Probes None
GENEFINDER00000044007 2/11 Cross Hyb Matching Probes None
F26G1.7 1/11 Cross Hyb Matching Probes A 
C33F10.9 1/11 Cross Hyb Matching Probes A 
R05F9.3 1/11 Cross Hyb Matching Probes R A 
R05F9.13 2/11 Cross Hyb Matching Probes A 
F59A6.8 2/11 Cross Hyb Matching Probes None
F58A6.8 1/11 Cross Hyb Matching Probes A 
C34F11.6 1/11 Cross Hyb Matching Probes A 
C34F11.4 1/11 Cross Hyb Matching Probes A 
C09B9.6 5/11 Cross Hyb Matching Probes A 
R13H9.2 4/11 Cross Hyb Matching Probes A 
R13H9.4 3/11 Cross Hyb Matching Probes A 
Y59E9AR.7 3/11 Cross Hyb Matching Probes A 
Y59E9AR.1 3/11 Cross Hyb Matching Probes A 
F36H12.7 3/11 Cross Hyb Matching Probes A 
ZK354.5 4/11 Cross Hyb Matching Probes A 
ZK354.4 5/11 Cross Hyb Matching Probes A 
ZK354.10 5/11 Cross Hyb Matching Probes None
ZK354.11 4/11 Cross Hyb Matching Probes A 
ZK354.1 3/11 Cross Hyb Matching Probes A 
T13F2.10 1/11 Cross Hyb Matching Probes A 
W08D2.9 1/11 Cross Hyb Matching Probes None
K07F5.1 1/11 Cross Hyb Matching Probes A 
K07F5.2 1/11 Cross Hyb Matching Probes A 
K07F5.3 1/11 Cross Hyb Matching Probes A 
F32B6.6 1/11 Cross Hyb Matching Probes A 
C04G2.4 1/11 Cross Hyb Matching Probes A 
K08F4.8 1/11 Cross Hyb Matching Probes A 
Genomic Alignment of Consensus/Exemplar Sequence
Assembly Wormbase March 2004
Alignment(s)
Position Identity Coverage Cytoband
chrII:4933009-4933393(+) 91.93 91.93
chrIV:8571425-8571809(+) 100.0 100.0
chrIV:5249434-5249815(+) 94.53 94.53
chrIV:5260583-5260967(+) 94.79 94.79
chrIV:5297956-5298340(+) 94.79 94.79
chrIV:5316517-5316901(+) 94.27 94.27
chrIV:5062573-5062957(+) 94.01 94.01
chrIV:9770025-9770409(+) 93.49 93.49
chrIV:10093057-10093457(+) 93.75 93.75
chrIV:9894608-9894992(+) 93.23 93.23
chrII:4916162-4916546(-) 93.49 93.49
chrII:5012855-5013236(-) 91.93 91.93
chrIV:5312722-5313106(-) 96.09 96.09
chrIV:5055626-5056010(-) 95.31 95.31
chrIV:5241396-5241777(-) 94.53 94.53
chrIV:5064673-5065057(-) 94.79 94.79
chrIV:5294951-5295335(-) 94.53 94.53
chrIV:9766750-9767134(-) 93.49 93.49
chrIV:9836013-9836397(-) 93.23 93.23
chrIV:10143333-10143717(-) 92.97 92.97
Public Domain and Genome References
Gene Title
Ensembl Y59H11AM.1
Entrez Gene 190425 Entrez gene
SwissProt Q95XU7 EMBL-EBI
WormBase CE25520 Wormbase
Functional Annotations
Gene Ontology
GO Molecular Function (view graph)
ID Description Evidence Links
5198 structural molecule activity inferred from electronic annotation QuickGO AmiGO
Protein Similarities
Method ID Description E-Value
blast AAK68539 Hypothetical protein Y59H11AM.1 [Caenorhabditis elegans] ref|NP_501464.1| Y59H11AM.1 [Caenorhabditis elegans] 1.0E-71
blast AAA85761 Major sperm protein protein 50 [Caenorhabditis elegans] emb|CAA94282.1| Hypothetical protein K07F5.1 [Caenorhabditis elegans] gb|AAK85493.1| Major sperm protein protein 53 [Caenorhabditis elegans] gb|AAB42254.1| Major sperm protein protein 51 [Caenorhabditis elegans] gb|AAB42255.1| Major sperm protein protein 113 [Caenorhabditis elegans] gb|AAB42253.1| Major sperm protein protein 59 [Caenorhabditis elegans] gb|AAB42256.1| Major sperm protein protein 65 [Caenorhabditis elegans] gb|AAC71087.1| Major sperm protein protein 64 [Caenorhabditis elegans] gb|AAA68711.1| Major sperm protein protein 142 [Caenorhabditis elegans] gb|AAA96204.1| Major sperm protein protein 45 [Caenorhabditis elegans] gb|AAC26926.1| Major sperm protein protein 19 [Caenorhabditis elegans] ref|NP_500773.1| Major Sperm Protein family member (msp-113) [Caenorhabditis elegans] ref|NP_500771.1| Major Sperm Protein family member (msp-51) [Caenorhabditis elegans] ref|NP_501759.1| Major Sperm Protein family member (msp-81) [Caenorhabditis elegans] ref|NP_500780.1| Major Sperm Protein family member (msp-65) [Caenorhabditis elegans] ref|NP_500778.1| Major Sperm Protein family member (msp-59) [Caenorhabditis elegans] ref|NP_500760.1| Major Sperm Protein family member (msp-19) [Caenorhabditis elegans] ref|NP_500714.1| Major Sperm Protein family member (msp-53) [Caenorhabditis elegans] ref|NP_495149.1| Major Sperm Protein family member (msp-64) [Caenorhabditis elegans] ref|NP_495144.1| Major Sperm Protein family member (msp-142) [Caenorhabditis elegans] ref|NP_494972.1| Major Sperm Protein family member (msp-50) [Caenorhabditis elegans] ref|NP_494959.1| Major Sperm Protein family member (msp-45) [Caenorhabditis elegans] ref|NP_494898.1| Major Sperm Protein family member (msp-31) [Caenorhabditis elegans] ref|NP_494865.1| Major Sperm Protein family member (msp-40) [Caenorhabditis elegans] gb|AAK31477.1| Major sperm protein protein 40 [Caenorhabditis elegans] gb|AAA83175.1| Major sperm protein protein 31 [Caenorhabditis elegans] sp|P53017|MSP19_CAEEL Major sperm protein 19/31/40/45/50/51/53/59/61/65/81/113/142 (MSP) 3.0E-71
blast CAB03362 Hypothetical protein T13F2.11 [Caenorhabditis elegans] ref|NP_501742.1| Major Sperm Protein family member (msp-78) [Caenorhabditis elegans] sp|Q94053|MSP78_CAEEL Major sperm protein 78 (MSP) 4.0E-71
Protein Domains
Database ID Description E-Value
Pfam IPR000535 EMBL-EBI Major sperm protein (MSP) domain 8.3E-35
Sequence
Target Sequence
>C. ELEGANS:172113_X_AT
tctgtcccaccaggagacatccaaacccagccgggtaccaagatcgtcttcaatgcccca
tacgatgacaaacacacctaccacatcaaggtgatcaactcatcggctcgccgtattgga
tacggtatcaagaccaccaatatgaagagagttggagttgatccaccgtgtggagttctc
gacccaaaagaagctgtgctgttggctgtttcctgtgatgctttcgcattcggacaagaa
gacaccaacaacgaccgtatcactgttgagtggaccaacaccccggatggagctgcaaag
caattccgccgtgaatggttccaa


BLASTn GenBank NR
Probe Info
Probe Sequence(5'-3') Probe X Probe Y Probe Interrogation
Position
Strandedness
TCTGTCCCACCAGGAGACATCCAAA 21 609 22 Antisense
TCGTCTTCAATGCCCCATACGATGA 601 601 65 Antisense
TACGATGACAAACACACCTACCACA 610 647 82 Antisense
ATCAACTCATCGGCTCGCCGTATTG 54 27 115 Antisense
GAGTTGGAGTTGATCCACCGTGTGG 584 397 170 Antisense
CCGTGTGGAGTTCTCGACCCAAAAG 148 265 187 Antisense
AGAAGCTGTGCTGTTGGCTGTTTCC 686 73 210 Antisense
TCCTGTGATGCTTTCGCATTCGGAC 410 593 232 Antisense
GACACCAACAACGACCGTATCACTG 158 369 262 Antisense
ACTGTTGAGTGGACCAACACCCCGG 477 97 283 Antisense
GCAATTCCGCCGTGAATGGTTCCAA 204 317 321 Antisense
Sequence Source Affymetrix Proprietary Database