[Home] | [Total List]

[172063_x_at] transmembrane transporter

Description g8132061 /REP_DB=GenBank Identifier /GB=AF152095.1 /PROTEIN_GB=AAF73198.1 /CHR=4 /FEA=Mapped Transcript /DEF=multispecific organic anion transporter
Cluster 6grp_highest_10_10 > 32      6grp_high1_10_10 > 13      4grp_highest_8_8 > 41      4grp_high_8_8 > 50      6grp_highest_nonorm > 40      6grp_total > 24      4grp_total > 53      6grp_highest_sub > De      6grp_cgc > 30      6grp_high1_sub > De      6grp_cgc_sub > De      6grp_total_sub > Decrease      6grp_rule_based > S1      4grp_rule_based > L1      

Scale

Warning: fopen(./gnuplot/172063_x_at_1_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/172063_x_at_1_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/172063_x_at_2_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/172063_x_at_2_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 1097
1 2 3 4 range
A 1153.9
(3)
P
980.1
(1.6)
P
817.5
(0.4)
P
383.4
(-3)
P
771
B 1265.7
(3)
P
889.6
(0.8)
P
912.7
(0.9)
P
260.1
(-3)
P
1006
C 1287.1
(3)
P
804.5
(0.4)
P
881.5
(0.8)
P
190.2
(-3)
P
1097
avr 1235.6
(3)
891.4
(0.8)
870.6
(0.7)
277.9
(-3)
958

Warning: fopen(./gnuplot/172063_x_at_dSignal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/172063_x_at_dSignal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 685
1 2 3 4 5 6 range
A 946.2
(3)
P
817.7
(1.9)
P
855.3
(2.2)
P
574.1
(-0.3)
P
363.6
(-2.2)
P
271.1
(-3)
P
675
B 955.7
(3)
P
871.4
(2.2)
P
589.6
(-0.5)
P
610.9
(-0.3)
P
355.5
(-2.7)
P
320.9
(-3)
P
635
C 773.8
(1.7)
P
907.5
(3)
P
611.2
(0.2)
P
490.1
(-1)
P
358.6
(-2.2)
P
276.3
(-3)
P
631
avr 891.9
(3)
865.5
(2.7)
685.4
(0.9)
558.4
(-0.3)
359.2
(-2.3)
289.4
(-3)
603
No Scale

Warning: fopen(./gnuplot/172063_x_at_1_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/172063_x_at_1_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/172063_x_at_2_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/172063_x_at_2_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 394
1 2 3 4 range
A 420.2
(3)
P
212.7
(-0.4)
P
213.7
(-0.4)
P
56.1
(-3)
P
364
B 403.6
(3)
P
219.7
(-0.2)
P
211.5
(-0.3)
P
55.4
(-3)
P
348
C 426.1
(3)
P
231.3
(0)
P
307.2
(1.2)
P
32.1
(-3)
P
394
avr 416.6
(3)
221.2
(-0.2)
244.1
(0.2)
47.9
(-3)
369

Warning: fopen(./gnuplot/172063_x_at_dNo_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/172063_x_at_dNo_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 267
1 2 3 4 5 6 range
A 174.4
(-0.1)
P
290.8
(3)
P
186.3
(0.2)
P
145.6
(-0.9)
P
109.7
(-1.8)
P
66
(-3)
P
225
B 332.5
(3)
P
290
(1.8)
P
143.2
(-2.3)
P
161.8
(-1.8)
P
144.4
(-2.3)
P
119.7
(-3)
P
213
C 286.8
(3)
P
276.9
(2.7)
P
155.6
(-1.1)
P
98.6
(-2.8)
P
116
(-2.3)
P
92.5
(-3)
P
194
avr 264.6
(2.3)
285.9
(3)
161.7
(-0.9)
135.3
(-1.7)
123.4
(-2)
92.7
(-3)
193
NetAffx Links Cluster Members
Consensus/Exemplar
Group Members
GeneChip Array Information
Probe Set ID 172063_x_at
GeneChip Array C. elegans Genome Array
Organism Common Name Nematode
Probe Design Information
Transcript ID(Array Design) affy.Ce.19846
Sequence Type Exemplar sequence
Representative Public ID 8132061 NCBI
Target Description g8132061 /REP_DB=GenBank Identifier /GB=AF152095.1 /PROTEIN_GB=AAF73198.1 /CHR=4 /FEA=Mapped Transcript /DEF=multispecific organic anion transporter
Cluster Evidence This cluster is supported by a Mapped Transcript.
Annotation Method Description
Annotation Description This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s).
Annotation Grade This is a grade A annotation.
Annotation Transcript Cluster (# of Matching Probes) NM_069041(11)
Transcript Assignments
Representative
Transcript
Description Matching Probes Related Probesets by Grade
NM_069041 NCBI Caenorhabditis elegans Organic Anion Transporter family member (oat-1) (oat-1) mRNA, complete cds. 11/11 A 
SNAP00000008420 ENSEMBL cdna:SNAP chromosome:CEL140:IV:8464834:8472571:-1 11/11 None
GENEFINDER00000008422 ENSEMBL cdna:GeneFinder chromosome:CEL140:IV:8464834:8466557:-1 11/11 None
T01B11.7.2 ENSEMBL cdna:known chromosome:CEL140:IV:8464742:8472575:-1 gene:T01B11.7 11/11 None
T01B11.7.1 ENSEMBL cdna:known chromosome:CEL140:IV:8464750:8472577:-1 gene:T01B11.7 11/11 None
Annotation Notes
There are no noteworthy cross hybridizing mRNAs found for this probe set.
Genomic Alignment of Consensus/Exemplar Sequence
Assembly Wormbase March 2004
Alignment(s)
Position Identity Coverage Cytoband
chrIV:8464744-8472583(-) 100.0 100.0
Public Domain and Genome References
Gene Title transmembrane transporter
Gene Symbol oat-1
Ensembl T01B11.7
Entrez Gene 177649 Entrez gene
SwissProt Q9NJF1 EMBL-EBI
WormBase CE30160 Wormbase
Functional Annotations
Gene Ontology
GO Biological Process (view graph)
ID Description Evidence Links
6810 transport inferred from electronic annotation QuickGO AmiGO
GO Cellular Component (view graph)
ID Description Evidence Links
16020 membrane inferred from electronic annotation QuickGO AmiGO
16021 integral to membrane inferred from electronic annotation QuickGO AmiGO
GO Molecular Function (view graph)
ID Description Evidence Links
5215 transporter activity inferred from electronic annotation QuickGO AmiGO
Protein Similarities
Method ID Description E-Value
blast AAB38003 Organic anion transporter protein 1 [Caenorhabditis elegans] ref|NP_501442.2| Organic Anion Transporter family member (oat-1) [Caenorhabditis elegans] gb|AAF73198.1| multispecific organic anion transporter [Caenorhabditis elegans] 0.0
blast CAE71545 Hypothetical protein CBG18488 [Caenorhabditis briggsae] 0.0
blast T25851 hypothetical protein T01B11.5 - Caenorhabditis elegans 0.0
Protein Domains
Database ID Description E-Value
Pfam IPR005828 EMBL-EBI General substrate transporter 2.8E-9
Pfam IPR005828 EMBL-EBI General substrate transporter 1.6E-10
Trans Membrane
ID Number Of Domains Domain Boundaries
NP_501442.2 10 49-71,155-172,179-201,211-233,238-257,328-350,357-379,394-413,418-437,478-500
T01B11.7.2 10 49-71,155-172,179-201,211-233,238-257,328-350,357-379,394-413,418-437,478-500
T01B11.7.1 10 49-71,155-172,179-201,211-233,238-257,328-350,357-379,394-413,418-437,478-500
SNAP00000008420 10 49-71,155-172,179-201,211-233,238-257,328-350,357-379,394-413,418-437,478-500
Sequence
Target Sequence
>C. ELEGANS:172063_X_AT
cagtgcgattattggggccgctcgctgggtagtcaacattgttgtgagcattgctgatta
tcagctcccatggtttggacgtcggttgattaatcatatatcaatgatattcacattagc
cagtttggcaattgttgccggatatgtttacattggaaatggtggatatgttgttgcaat
tggaactactgtagctcttgctatgtgctcacaacttttcattgcaaaatatttgatggt
taatgagctgtatccaacggctgtaagaaatttggcagtatctgctgtttcaacaatgag
cagagttggaggaatgttttcaccacagttgttttacttgagtgacatagctgagtggat
cccgtacgcagttctagttggattccaacttgttgacctagtcttgttctgtataacaat
tccagaaacaaaaggagttcatttggaaaatcatctacctccagagcata


BLASTn GenBank NR
Probe Info
Probe Sequence(5'-3') Probe X Probe Y Probe Interrogation
Position
Strandedness
CAGTGCGATTATTGGGGCCGCTCGC 476 207 1104 Antisense
CGCTCGCTGGGTAGTCAACATTGTT 564 255 1122 Antisense
TATCAGCTCCCATGGTTTGGACGTC 258 651 1162 Antisense
GTAGCTCTTGCTATGTGCTCACAAC 338 457 1294 Antisense
TAATGAGCTGTATCCAACGGCTGTA 122 637 1344 Antisense
GGCAGTATCTGCTGTTTCAACAATG 138 537 1377 Antisense
GGAGGAATGTTTTCACCACAGTTGT 323 515 1411 Antisense
GTGACATAGCTGAGTGGATCCCGTA 613 479 1445 Antisense
GATCCCGTACGCAGTTCTAGTTGGA 97 381 1461 Antisense
GTTGACCTAGTCTTGTTCTGTATAA 44 439 1495 Antisense
GAAAATCATCTACCTCCAGAGCATA 542 353 1549 Antisense
Sequence Source GenBank