[Home] | [Total List]

[172018_x_at] mitogen inducible MIG-2 protein like

Description g6636371 /REP_DB=GenBank Identifier /GB=AF217185.1 /PROTEIN_GB=AAF20162.1 /CHR=5 /FEA=Mapped Transcript /DEF=UNC-112
Cluster 6grp_highest_10_10 > 06      6grp_high1_10_10 > 32      4grp_highest_8_8 > 16      4grp_high_8_8 > 52      6grp_highest_nonorm > 22      6grp_total > 31      4grp_total > 59      6grp_highest_sub > 04      6grp_cgc > 62      6grp_high1_sub > 02_03      6grp_cgc_sub > 02      6grp_total_sub > Hat      4grp_rule_based > L2      

Scale

Warning: fopen(./gnuplot/172018_x_at_1_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/172018_x_at_1_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/172018_x_at_2_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/172018_x_at_2_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 1652
1 2 3 4 range
A 1046.9
(0.1)
P
1847.3
(3)
P
1620.8
(2.2)
P
195.1
(-3)
P
1652
B 1250
(2)
P
1436.8
(3)
P
1277.6
(2.2)
P
272
(-3)
P
1165
C 951.1
(-0.4)
P
1463.9
(1.7)
P
1791.7
(3)
P
294.3
(-3)
P
1497
avr 1082.7
(0.7)
1582.7
(3)
1563.4
(2.9)
253.8
(-3)
1329

Warning: fopen(./gnuplot/172018_x_at_dSignal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/172018_x_at_dSignal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 1538
1 2 3 4 5 6 range
A 1420.9
(0.3)
P
2007.3
(3)
P
1634.4
(1.3)
P
1758.4
(1.9)
P
1188.1
(-0.7)
P
682.4
(-3)
P
1325
B 1140.4
(-1)
P
1610.2
(3)
P
1157.1
(-0.9)
P
1543.7
(2.4)
P
1078
(-1.6)
P
913.2
(-3)
P
697
C 1767.6
(1.7)
P
1816.5
(1.9)
P
2089.4
(3)
P
1736.3
(1.6)
P
1194
(-0.5)
P
551
(-3)
P
1538
avr 1443
(1)
1811.3
(3)
1627
(2)
1679.5
(2.3)
1153.4
(-0.6)
715.5
(-3)
1096
No Scale

Warning: fopen(./gnuplot/172018_x_at_1_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/172018_x_at_1_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/172018_x_at_2_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/172018_x_at_2_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 596
1 2 3 4 range
A 381.2
(2.4)
P
401
(2.7)
P
423.7
(3)
P
28.6
(-3)
P
395
B 398.6
(3)
P
354.8
(2.2)
P
296
(1.2)
P
58
(-3)
P
341
C 314.8
(-0.2)
P
420.9
(0.9)
P
624.5
(3)
P
49.6
(-3)
P
575
avr 364.9
(1.8)
392.2
(2.2)
448.1
(3)
45.4
(-3)
403

Warning: fopen(./gnuplot/172018_x_at_dNo_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/172018_x_at_dNo_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 548
1 2 3 4 5 6 range
A 261.9
(-2)
P
713.9
(3)
P
355.9
(-0.9)
P
446
(0.1)
P
358.5
(-0.9)
P
166.1
(-3)
P
548
B 396.8
(-0.3)
P
536
(3)
P
281
(-3)
P
408.9
(0)
P
438
(0.7)
P
340.5
(-1.6)
P
255
C 655.2
(3)
P
554.3
(1.7)
P
531.8
(1.4)
P
349.2
(-0.9)
P
386.4
(-0.4)
P
184.4
(-3)
P
471
avr 438
(0.4)
601.4
(3)
389.6
(-0.4)
401.4
(-0.2)
394.3
(-0.3)
230.3
(-3)
371
NetAffx Links Cluster Members
Consensus/Exemplar
Group Members
GeneChip Array Information
Probe Set ID 172018_x_at
GeneChip Array C. elegans Genome Array
Organism Common Name Nematode
Probe Design Information
Transcript ID(Array Design) affy.Ce.19925
Sequence Type Exemplar sequence
Representative Public ID 6636371 NCBI
Target Description g6636371 /REP_DB=GenBank Identifier /GB=AF217185.1 /PROTEIN_GB=AAF20162.1 /CHR=5 /FEA=Mapped Transcript /DEF=UNC-112
Cluster Evidence This cluster is supported by a Mapped Transcript.
Annotation Method Description
Annotation Description This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s).
Annotation Grade This is a grade A annotation.
Annotation Transcript Cluster (# of Matching Probes) NM_074227(11)
Transcript Assignments
Representative
Transcript
Description Matching Probes Related Probesets by Grade
NM_074227 NCBI Caenorhabditis elegans UNCoordinated family member (unc-112) (unc-112) mRNA, complete cds. 11/11 A 
C47E8.7.1 ENSEMBL cdna:known chromosome:CEL140:V:14694441:14699522:-1 gene:C47E8.7 11/11 A 
C47E8.7.2 ENSEMBL cdna:known chromosome:CEL140:V:14694458:14699243:-1 gene:C47E8.7 11/11 A 
Annotation Notes
Cross Hybridizing mRNA Matched Probes Nature of Assignment Related Probesets by Grade
SNAP00000005838 8/11 Cross Hyb Matching Probes None
GENEFINDER00000005851 8/11 Cross Hyb Matching Probes None
Genomic Alignment of Consensus/Exemplar Sequence
Assembly Wormbase March 2004
Alignment(s)
Position Identity Coverage Cytoband
chrV:14694440-14699506(-) 98.62 100.0
Public Domain and Genome References
Gene Title mitogen inducible MIG-2 protein like
Gene Symbol unc-112
Ensembl C47E8.7
Entrez Gene 179972 Entrez gene
SwissProt Q18685 EMBL-EBI
WormBase CE05443 Wormbase
Functional Annotations
Ortholog
ID Title Organism
CANINE_2:CFA.10802.1.S1_AT similar to pleckstrin homology domain containing, family C (with FERM domain) member 1 cfa
CANINE_2:CFA.15586.1.A1_AT similar to pleckstrin homology domain containing, family C (with FERM domain) member 1 cfa
CANINE_2:CFAAFFX.22858.1.S1_S_AT similar to pleckstrin homology domain containing, family C (with FERM domain) member 1 cfa
DROSOPHILA_2:1637149_S_AT Fermitin 1 dm
DROSGENOME1:154757_AT Fermitin 1 dm
CHICKEN:GGA.15774.1.S1_AT pleckstrin homology domain containing, family C (with FERM domain) member 1 gga
CHICKEN:GGA.17513.1.S1_AT pleckstrin homology domain containing, family C (with FERM domain) member 1 gga
CHICKEN:GGAAFFX.23900.2.S1_S_AT pleckstrin homology domain containing, family C (with FERM domain) member 1 gga
HU35KSUBC:RC_D59714_S_AT pleckstrin homology domain containing, family C (with FERM domain) member 1 hs
HUGENEFL:Z24725_AT pleckstrin homology domain containing, family C (with FERM domain) member 1 hs
HG-U133A:209210_S_AT pleckstrin homology domain containing, family C (with FERM domain) member 1 hs
HG-U133_PLUS_2:209210_S_AT pleckstrin homology domain containing, family C (with FERM domain) member 1 hs
HG-U133A_2:209210_S_AT pleckstrin homology domain containing, family C (with FERM domain) member 1 hs
U133_X3P:G505032_3P_A_AT pleckstrin homology domain containing, family C (with FERM domain) member 1 hs
U133_X3P:HS.75260.1.S1_3P_A_AT pleckstrin homology domain containing, family C (with FERM domain) member 1 hs
U133_X3P:HS.75260.0.S1_3P_A_AT pleckstrin homology domain containing, family C (with FERM domain) member 1 hs
HG-U133A_2:209209_S_AT pleckstrin homology domain containing, family C (with FERM domain) member 1 hs
HG-U133_PLUS_2:209209_S_AT pleckstrin homology domain containing, family C (with FERM domain) member 1 hs
HG-U133A:209209_S_AT pleckstrin homology domain containing, family C (with FERM domain) member 1 hs
HG-U133A_2:214212_X_AT pleckstrin homology domain containing, family C (with FERM domain) member 1 hs
HG-U133_PLUS_2:214212_X_AT pleckstrin homology domain containing, family C (with FERM domain) member 1 hs
HG-U133A:214212_X_AT pleckstrin homology domain containing, family C (with FERM domain) member 1 hs
HG-U95AV2:36577_AT pleckstrin homology domain containing, family C (with FERM domain) member 1 hs
HG-U95E:71961_AT Pleckstrin homology domain containing, family C (with FERM domain) member 1 hs
HG-U95E:78845_AT Pleckstrin homology domain containing, family C (with FERM domain) member 1 hs
RG-U34B:RC_AA964601_AT pleckstrin homology domain containing, family C (with FERM domain) member 1 (predicted) rn
RG-U34C:RC_AI171276_AT pleckstrin homology domain containing, family C (with FERM domain) member 1 (predicted) rn
RAE230A:1398327_AT pleckstrin homology domain containing, family C (with FERM domain) member 1 (predicted) rn
RAT230_2:1398327_AT pleckstrin homology domain containing, family C (with FERM domain) member 1 (predicted) rn
RAE230B:1384182_AT pleckstrin homology domain containing, family C (with FERM domain) member 1 (predicted) rn
RAT230_2:1384182_AT pleckstrin homology domain containing, family C (with FERM domain) member 1 (predicted) rn
Gene Ontology
GO Cellular Component (view graph)
ID Description Evidence Links
5856 cytoskeleton inferred from electronic annotation QuickGO AmiGO
30055 cell-matrix junction inferred from direct assay QuickGO AmiGO
5886 plasma membrane inferred from direct assay QuickGO AmiGO
GO Molecular Function (view graph)
ID Description Evidence Links
5198 structural molecule activity inferred from mutant phenotype QuickGO AmiGO
Protein Similarities
Method ID Description E-Value
blast CAA99790 Hypothetical protein C47E8.7 [Caenorhabditis elegans] ref|NP_506628.1| UNCoordinated family member (unc-112) [Caenorhabditis elegans] gb|AAF20162.1| UNC-112 [Caenorhabditis elegans] sp|Q18685|UN112_CAEEL Uncoordinated protein 112 (Mitogen inducible mig-2 protein-like) 0.0
blast CAE60849 Hypothetical protein CBG04558 [Caenorhabditis briggsae] 0.0
blast XP_392367 PREDICTED: similar to ENSANGP00000019858 [Apis mellifera] 1.0E-158
Protein Domains
Database ID Description E-Value
Pfam IPR001849 EMBL-EBI Pleckstrin-like 7.7E-15
Sequence
Target Sequence
>C. ELEGANS:172018_X_AT
gaaaggcggaattggtggctgttgctgtgaatagacttgcaaaattgaatatggataatg
gagaaagtctgaagacatggaggtttgcaaatatgaagaagtggcatgtcaactgggaaa
ttcgacatctcaagattcaattcgaagatgaggatatcgaattcaagccactttccgctg
attgcaaagtcgttcacgagttcatcggtggatacattttcctgtcaatgcgaagcaaag
aacattctcaaaatcttgatgaagaacttttccacaaacttacaggaggatgggcttaga
tatttaaatttctataatcttttgcaaaccaaagaattttaattttaggctccaattcca
tctttttcgtttcaaaatttcaatatatatatttgttttctttcatttttcttgtttctc
atttccccccttcccctcttccaaataatttttcgttttaataagacaagtataccggat
cgaaaaaaagttttatgtgccttttcatatctat


BLASTn GenBank NR
Probe Info
Probe Sequence(5'-3') Probe X Probe Y Probe Interrogation
Position
Strandedness
GAAAGGCGGAATTGGTGGCTGTTGC 88 361 2165 Antisense
GGTGGCTGTTGCTGTGAATAGACTT 332 499 2178 Antisense
GTGGCATGTCAACTGGGAAATTCGA 549 489 2265 Antisense
TATCGAATTCAAGCCACTTTCCGCT 155 657 2319 Antisense
TTCCGCTGATTGCAAAGTCGTTCAC 181 697 2337 Antisense
AGTCGTTCACGAGTTCATCGGTGGA 65 59 2352 Antisense
ATCGGTGGATACATTTTCCTGTCAA 293 35 2368 Antisense
GAAGAACTTTTCCACAAACTTACAG 11 339 2425 Antisense
TTTTAGGCTCCAATTCCATCTTTTT 472 675 2507 Antisense
TTCTTTCATTTTTCTTGTTTCTCAT 381 691 2562 Antisense
GTTTTATGTGCCTTTTCATATCTAT 340 449 2654 Antisense
Sequence Source GenBank