[Home] | [Total List]

[171984_at] ATP synthase alpha and beta subunits ; ATP synthase ab C terminal

Description AV179943_rc /REP_DB=TREMBL Accession /GB=AV179943 /FEA=Transcript Cluster /DEF=Caenorhabditis elegans cDNA clone:yk600c2 : 3prime end, single read.
Cluster 6grp_highest_10_10 > 70      6grp_high1_10_10 > 05      4grp_highest_8_8 > 16      4grp_high_8_8 > 52      6grp_highest_nonorm > 30      6grp_total > 05      4grp_total > 60      6grp_highest_sub > De      6grp_cgc > 22      6grp_high1_sub > De      6grp_cgc_sub > De      4grp_rule_based > L2      

Scale

Warning: fopen(./gnuplot/171984_at_1_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/171984_at_1_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/171984_at_2_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/171984_at_2_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 936
1 2 3 4 range
A 1049.4
(-0.1)
P
1409.7
(3)
P
1300.9
(2.1)
P
717.4
(-3)
P
692
B 1144.9
(3)
P
987.4
(1.6)
P
889.5
(0.7)
P
473.7
(-3)
P
671
C 985.5
(0.5)
P
1244.4
(3)
P
1180
(2.4)
P
630.5
(-3)
P
614
avr 1059.9
(1.5)
1213.8
(3)
1123.5
(2.1)
607.2
(-3)
607

Warning: fopen(./gnuplot/171984_at_dSignal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/171984_at_dSignal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 1249
1 2 3 4 5 6 range
A 1242
(3)
P
1117.4
(2.1)
P
815.1
(-0.2)
P
715.4
(-0.9)
P
834.9
(-0)
P
436.6
(-3)
P
805
B 1176.2
(3)
P
1052.3
(1.9)
P
619.9
(-2)
P
658.6
(-1.6)
P
635.5
(-1.8)
P
506.6
(-3)
P
670
C 1616.6
(3)
P
674.2
(-1.5)
P
794
(-1)
P
774.5
(-1)
P
1003
(0.1)
P
367.2
(-3)
P
1249
avr 1344.9
(3)
948
(0.4)
743
(-1)
716.2
(-1.2)
824.5
(-0.4)
436.8
(-3)
908
No Scale

Warning: fopen(./gnuplot/171984_at_1_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/171984_at_1_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/171984_at_2_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/171984_at_2_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 310
1 2 3 4 range
A 382.1
(3)
P
306
(1.4)
P
340.1
(2.1)
P
105
(-3)
P
277
B 365.1
(3)
P
243.9
(0.2)
P
206.1
(-0.6)
P
100.9
(-3)
P
264
C 326.2
(1.3)
P
357.8
(1.9)
P
411.3
(3)
P
106.3
(-3)
P
305
avr 357.8
(3)
302.6
(1.7)
319.2
(2.1)
104.1
(-3)
254

Warning: fopen(./gnuplot/171984_at_dNo_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/171984_at_dNo_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 493
1 2 3 4 5 6 range
A 229
(-0.5)
P
397.4
(3)
P
177.5
(-1.5)
P
181.4
(-1.5)
P
252
(0)
P
106.3
(-3)
P
291
B 409.3
(3)
P
350.3
(1.6)
P
150.5
(-3)
P
174.5
(-2.4)
P
258.2
(-0.5)
P
188.9
(-2.1)
P
259
C 599.2
(3)
P
205.7
(-2)
P
202.1
(-2)
P
155.8
(-2.6)
P
324.6
(-0.5)
P
122.9
(-3)
P
476
avr 412.5
(3)
317.8
(0.9)
176.7
(-2.2)
170.6
(-2.3)
278.3
(0.1)
139.4
(-3)
273
NetAffx Links Cluster Members
Consensus/Exemplar
GeneChip Array Information
Probe Set ID 171984_at
GeneChip Array C. elegans Genome Array
Organism Common Name Nematode
Probe Design Information
Transcript ID(Array Design) affy.Ce.27680
Sequence Type Exemplar sequence
Representative Public ID AV179943 NCBI
Target Description AV179943_rc /REP_DB=TREMBL Accession /GB=AV179943 /FEA=Transcript Cluster /DEF=Caenorhabditis elegans cDNA clone:yk600c2 : 3prime end, single read.
Cluster Evidence This cluster is supported by a Transcript Cluster.
Annotation Method Description
Annotation Description This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s).
Annotation Grade This is a grade A annotation.
Annotation Transcript Cluster (# of Matching Probes) NM_074158(10)
Transcript Assignments
Representative
Transcript
Description Matching Probes Related Probesets by Grade
NM_074158 NCBI Caenorhabditis elegans Vacuolar H ATPase family member (vha-13) (vha-13) mRNA, complete cds. 10/11 None
Y49A3A.2.3 ENSEMBL cdna:known chromosome:CEL140:V:14353501:14357009:1 gene:Y49A3A.2 10/11 None
Y49A3A.2.4 ENSEMBL cdna:known chromosome:CEL140:V:14354297:14357009:1 gene:Y49A3A.2 10/11 None
Y49A3A.2.2 ENSEMBL cdna:known chromosome:CEL140:V:14354297:14357009:1 gene:Y49A3A.2 10/11 A 
Y49A3A.2.1 ENSEMBL cdna:known chromosome:CEL140:V:14354299:14357009:1 gene:Y49A3A.2 10/11 A 
Annotation Notes
There are no noteworthy cross hybridizing mRNAs found for this probe set.
Genomic Alignment of Consensus/Exemplar Sequence
Assembly Wormbase March 2004
Alignment(s)
Position Identity Coverage Cytoband
chrV:14356662-14356944(+) 89.58 89.58
Public Domain and Genome References
Gene Title ATP synthase alpha and beta subunits ; ATP synthase ab C terminal
Gene Symbol vha-13
Ensembl Y49A3A.2
Entrez Gene 3564970 Entrez gene
SwissProt Q9XW92 EMBL-EBI
WormBase CE22210 Wormbase
Functional Annotations
Ortholog
ID Title Organism
ATH1-121501:264302_AT vacuolar ATP synthase catalytic subunit A / V-ATPase A subunit / vacuolar proton pump alpha subunit / V-ATPase 69 kDa subunit at
ATGENOME1:12775_S_AT vacuolar ATP synthase catalytic subunit A / V-ATPase A subunit / vacuolar proton pump alpha subunit / V-ATPase 69 kDa subunit at
CANINE_2:CFAAFFX.16764.1.S1_AT similar to ATPase, H+ transporting, lysosomal 70kD, V1 subunit A, isoform 1 cfa
DROSOPHILA_2:1634961_S_AT dm
DROSGENOME1:146305_AT dm
CHICKEN:GGA.1712.1.S1_A_AT ATPase, H+ transporting, lysosomal 70kDa, V1 subunit A gga
CHICKEN:GGA.1712.2.S1_A_AT ATPase, H+ transporting, lysosomal 70kDa, V1 subunit A gga
HG-U133_PLUS_2:201972_AT ATPase, H+ transporting, lysosomal 70kDa, V1 subunit A hs
HG-U133A_2:201972_AT ATPase, H+ transporting, lysosomal 70kDa, V1 subunit A hs
HG-U133A:201972_AT ATPase, H+ transporting, lysosomal 70kDa, V1 subunit A hs
HG-FOCUS:201972_AT ATPase, H+ transporting, lysosomal 70kDa, V1 subunit A hs
HG-U133_PLUS_2:201971_S_AT ATPase, H+ transporting, lysosomal 70kDa, V1 subunit A hs
HG-U133A:201971_S_AT ATPase, H+ transporting, lysosomal 70kDa, V1 subunit A hs
HG-U133A_2:201971_S_AT ATPase, H+ transporting, lysosomal 70kDa, V1 subunit A hs
HU35KSUBA:RC_AA228122_AT ATPase, H+ transporting, lysosomal 70kDa, V1 subunit A hs
HUGENEFL:L09235_AT ATPase, H+ transporting, lysosomal 70kDa, V1 subunit A hs
U133_X3P:G6523820_3P_AT ATPase, H+ transporting, lysosomal 70kDa, V1 subunit A hs
U133_X3P:G4502304_3P_A_AT ATPase, H+ transporting, lysosomal 70kDa, V1 subunit A hs
HG-U95AV2:34889_AT ATPase, H+ transporting, lysosomal 70kDa, V1 subunit A hs
HG-U95AV2:34890_AT ATPase, H+ transporting, lysosomal 70kDa, V1 subunit A hs
HG-U95D:75635_R_AT ATPase, H+ transporting, lysosomal 70kDa, V1 subunit A hs
MOUSE430_2:1422508_AT ATPase, H+ transporting, V1 subunit A1 mm
MOUSE430A_2:1422508_AT ATPase, H+ transporting, V1 subunit A1 mm
MOE430A:1422508_AT ATPase, H+ transporting, V1 subunit A1 mm
MOUSE430_2:1450634_AT ATPase, H+ transporting, V1 subunit A1 mm
MOE430A:1450634_AT ATPase, H+ transporting, V1 subunit A1 mm
MOUSE430A_2:1450634_AT ATPase, H+ transporting, V1 subunit A1 mm
MU11KSUBB:MSA.14012.0_F_AT ATPase, H+ transporting, V1 subunit A1 mm
MU11KSUBB:MSA.1867.0_S_AT ATPase, H+ transporting, V1 subunit A1 mm
MOE430B:1445916_AT ATPase, H+ transporting, V1 subunit A1, mRNA (cDNA clone MGC:6531 IMAGE:2651677) mm
MOUSE430_2:1445916_AT ATPase, H+ transporting, V1 subunit A1, mRNA (cDNA clone MGC:6531 IMAGE:2651677) mm
MG-U74AV2:95746_AT ATPase, H+ transporting, V1 subunit A1, mRNA (cDNA clone MGC:6531 IMAGE:2651677) mm
MU19KSUBB:TC30326_AT ATPase, H+ transporting, V1 subunit A1, mRNA (cDNA clone MGC:6531 IMAGE:2651677) mm
MU19KSUBB:TC30326_G_AT ATPase, H+ transporting, V1 subunit A1, mRNA (cDNA clone MGC:6531 IMAGE:2651677) mm
MU19KSUBB:TC30327_AT ATPase, H+ transporting, V1 subunit A1, mRNA (cDNA clone MGC:6531 IMAGE:2651677) mm
RG-U34C:RC_AI071788_AT ATPase, H+ transporting, V1 subunit A, isoform 1 (predicted) rn
RAE230A:1382048_AT ATPase, H+ transporting, V1 subunit A, isoform 1 (predicted) rn
RAT230_2:1382048_AT ATPase, H+ transporting, V1 subunit A, isoform 1 (predicted) rn
RAE230A:1374431_AT ATPase, H+ transporting, V1 subunit A, isoform 1 (predicted) rn
RAT230_2:1374431_AT ATPase, H+ transporting, V1 subunit A, isoform 1 (predicted) rn
RG-U34A:RC_AA892006_AT ATPase, H+ transporting, V1 subunit A, isoform 1 (predicted) rn
RG-U34A:RC_AA893217_AT ATPase, H+ transporting, V1 subunit A, isoform 1 (predicted) rn
Gene Ontology
GO Biological Process (view graph)
ID Description Evidence Links
6754 ATP biosynthesis inferred from electronic annotation QuickGO AmiGO
15986 ATP synthesis coupled proton transport inferred from electronic annotation QuickGO AmiGO
GO Cellular Component (view graph)
ID Description Evidence Links
16469 proton-transporting two-sector ATPase complex inferred from electronic annotation QuickGO AmiGO
GO Molecular Function (view graph)
ID Description Evidence Links
5524 ATP binding inferred from electronic annotation QuickGO AmiGO
46933 hydrogen-transporting ATP synthase activity, rotational mechanism inferred from electronic annotation QuickGO AmiGO
46961 hydrogen-transporting ATPase activity, rotational mechanism inferred from electronic annotation QuickGO AmiGO
Protein Similarities
Method ID Description E-Value
blast CAA22076 Hypothetical protein Y49A3A.2 [Caenorhabditis elegans] ref|NP_506559.1| Vacuolar H ATPase family member (vha-13) [Caenorhabditis elegans] 0.0
blast CAE60915 Hypothetical protein CBG04632 [Caenorhabditis briggsae] 0.0
blast P38607 Vacuolar ATP synthase catalytic subunit A, osteoclast isoform (V-ATPase A subunit 2) (Vacuolar proton pump alpha subunit 2) (V-ATPase 69 kDa subunit 2) (Isoform HO68) gb|AAA35578.1| ATPase 0.0
Protein Domains
Database ID Description E-Value
Pfam IPR004100 EMBL-EBI H+-transporting two-sector ATPase, alpha/beta subunit, N-terminal 2.0E-22
Pfam IPR000194 EMBL-EBI H+-transporting two-sector ATPase, alpha/beta subunit, central region 1.0E-87
Pfam IPR000793 EMBL-EBI H+-transporting two-sector ATPase, alpha/beta subunit, C-terminal 1.3E-52
Sequence
Target Sequence
>C. ELEGANS:171984_AT
tgtaataactttatcctctttaaagtgtttgattgatttgacattccaaatttcagatat
ttattgcaccnnnnnnctcttttgtagatttctaaacttcaanaaattccaaccacacac
aatgtatctggtcgccttacaactcccgttttaaacaacaatttattgttgtttaatcaa
tnnnnnnnntattcttcttgttgaatagactactttacttgtgccctt


BLASTn GenBank NR
Note: "n"'s represent regions that are not probed by the probe sequences.
Probe Info
Probe Sequence(5'-3') Probe X Probe Y Probe Interrogation
Position
Strandedness
TGTAATAACTTTATCCTCTTTAAAG 215 559 29 Antisense
TTATCCTCTTTAAAGTGTTTGATTG 376 681 39 Antisense
GTGTTTGATTGATTTGACATTCCAA 636 485 53 Antisense
TTGACATTCCAAATTTCAGATATTT 97 703 66 Antisense
CCAAATTTCAGATATTTATTGCACC 191 275 74 Antisense
CTCTTTTGTAGATTTCTAAACTTCA 49 221 105 Antisense
AAATTCCAACCACACACAATGTATC 574 115 132 Antisense
CACACACAATGTATCTGGTCGCCTT 195 195 142 Antisense
CAATGTATCTGGTCGCCTTACAACT 1 183 148 Antisense
TTCTTCTTGTTGAATAGACTACTTT 235 689 220 Antisense
AATAGACTACTTTACTTGTGCCCTT 188 173 232 Antisense
Sequence Source Affymetrix Proprietary Database