[Home] | [Total List]

[171912_x_at] glycosyl hydrolase (family 18)

Description AV182062_rc /REP_DB=TREMBL Accession /GB=AV182062 /FEA=Transcript Cluster /DEF=Caenorhabditis elegans cDNA clone:yk631f9 : 3prime end, single read.
Cluster 6grp_highest_10_10 > 86      6grp_high1_10_10 > 67      6grp_highest_nonorm > 98      6grp_total > 68      4grp_total > 39      6grp_highest_sub > Da      6grp_cgc > 38      6grp_high1_sub > Da      6grp_cgc_sub > Da      6grp_total_sub > Increase      6grp_rule_based > S6      

Scale

Warning: fopen(./gnuplot/171912_x_at_1_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/171912_x_at_1_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/171912_x_at_2_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/171912_x_at_2_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 383
1 2 3 4 range
A 455.9
(3)
P
128.3
(-3)
A
140.8
(-2.8)
P
171.3
(-2.2)
A
328
B 438
(3)
P
202.2
(-0.9)
A
73.2
(-3)
A
188.8
(-1.1)
A
365
C 436.1
(3)
P
128.4
(-2.6)
A
108.7
(-3)
A
196.2
(-1.4)
A
327
avr 443.3
(3)
153
(-2.2)
107.6
(-3)
185.4
(-1.6)
336

Warning: fopen(./gnuplot/171912_x_at_dSignal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/171912_x_at_dSignal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 2180
1 2 3 4 5 6 range
A 454.9
(-2.4)
P
651.2
(-1.8)
P
271.7
(-3)
P
345.6
(-2.8)
P
512.7
(-2.2)
P
2182.2
(3)
P
1910
B 821.7
(-0.9)
P
586.7
(-1.7)
P
184.7
(-3)
P
466.7
(-2.1)
P
515.8
(-1.9)
P
2023.8
(3)
P
1839
C 492.8
(-2.2)
P
517.6
(-2.1)
P
351.2
(-2.5)
P
186
(-3)
P
512.6
(-2.1)
P
2365.1
(3)
P
2179
avr 589.8
(-2)
585.2
(-2)
269.2
(-3)
332.8
(-2.8)
513.7
(-2.2)
2190.4
(3)
1921
No Scale

Warning: fopen(./gnuplot/171912_x_at_1_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/171912_x_at_1_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/171912_x_at_2_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/171912_x_at_2_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 149
1 2 3 4 range
A 166
(3)
P
27.9
(-2.9)
A
36.8
(-2.5)
P
25.1
(-3)
A
141
B 139.7
(3)
P
50
(-1.4)
A
17
(-3)
A
40.2
(-1.9)
A
123
C 144.4
(3)
P
36.9
(-2.8)
A
37.9
(-2.7)
A
33.1
(-3)
A
111
avr 150
(3)
38.3
(-2.6)
30.6
(-3)
32.8
(-2.9)
119

Warning: fopen(./gnuplot/171912_x_at_dNo_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/171912_x_at_dNo_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 754
1 2 3 4 5 6 range
A 83.9
(-2.7)
P
231.6
(-0.8)
P
59.2
(-3)
P
87.7
(-2.6)
P
154.7
(-1.8)
P
531.3
(3)
P
472
B 285.9
(-1)
P
195.3
(-1.7)
P
44.9
(-3)
P
123.6
(-2.3)
P
209.5
(-1.6)
P
754.7
(3)
P
710
C 182.7
(-1.8)
P
157.9
(-2)
P
89.4
(-2.6)
P
37.4
(-3)
P
165.9
(-2)
P
791.7
(3)
P
754
avr 184.2
(-1.9)
194.9
(-1.8)
64.5
(-3)
82.9
(-2.8)
176.7
(-1.9)
692.6
(3)
628
NetAffx Links Cluster Members
Consensus/Exemplar
Group Members
GeneChip Array Information
Probe Set ID 171912_x_at
GeneChip Array C. elegans Genome Array
Organism Common Name Nematode
Probe Design Information
Transcript ID(Array Design) affy.Ce.28027
Sequence Type Exemplar sequence
Representative Public ID AV182062 NCBI
Target Description AV182062_rc /REP_DB=TREMBL Accession /GB=AV182062 /FEA=Transcript Cluster /DEF=Caenorhabditis elegans cDNA clone:yk631f9 : 3prime end, single read.
Cluster Evidence This cluster is supported by a Transcript Cluster.
Annotation Method Description
Annotation Description This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s).
Annotation Grade This is a grade A annotation.
Annotation Transcript Cluster (# of Matching Probes) NM_076187(9)
Transcript Assignments
Representative
Transcript
Description Matching Probes Related Probesets by Grade
NM_076187 NCBI Caenorhabditis elegans CHiTinase family member (cht-1) (cht-1) mRNA, complete cds. 9/11 A 
C04F6.3.4 ENSEMBL cdna:known chromosome:CEL140:X:3397595:3400010:-1 gene:C04F6.3 9/11 None
C04F6.3.5 ENSEMBL cdna:known chromosome:CEL140:X:3397595:3400287:-1 gene:C04F6.3 9/11 None
C04F6.3.1 ENSEMBL cdna:known chromosome:CEL140:X:3397595:3400008:-1 gene:C04F6.3 9/11 A 
C04F6.3.3 ENSEMBL cdna:known chromosome:CEL140:X:3397595:3400006:-1 gene:C04F6.3 9/11 None
C04F6.3.2 ENSEMBL cdna:known chromosome:CEL140:X:3397595:3400004:-1 gene:C04F6.3 9/11 A 
Annotation Notes
Cross Hybridizing mRNA Matched Probes Nature of Assignment Related Probesets by Grade
SNAP00000029418 8/11 Cross Hyb Matching Probes None
GENEFINDER00000029427 8/11 Cross Hyb Matching Probes None
Genomic Alignment of Consensus/Exemplar Sequence
Assembly Wormbase March 2004
Alignment(s)
Position Identity Coverage Cytoband
chrX:3397716-3397969(-) 82.78 82.78
Public Domain and Genome References
Gene Title glycosyl hydrolase (family 18)
Gene Symbol cht-1
Ensembl C04F6.3
Entrez Gene 180628 Entrez gene
SwissProt Q11174 EMBL-EBI
WormBase CE03923 Wormbase
Functional Annotations
Ortholog
ID Title Organism
ATGENOME1:20420_AT glycosyl hydrolase family 18 protein at
ATH1-121501:254543_AT glycosyl hydrolase family 18 protein at
DROSOPHILA_2:1639636_AT dm
DROSGENOME1:148079_AT dm
HG-U133A:208168_S_AT chitinase 1 (chitotriosidase) hs
HG-U133_PLUS_2:208168_S_AT chitinase 1 (chitotriosidase) hs
HG-FOCUS:208168_S_AT chitinase 1 (chitotriosidase) hs
HG-U133A_2:208168_S_AT chitinase 1 (chitotriosidase) hs
HU35KSUBC:RC_T94579_S_AT chitinase 1 (chitotriosidase) hs
HUGENEFL:U29615_AT chitinase 1 (chitotriosidase) hs
U133_X3P:G4502808_3P_A_AT chitinase 1 (chitotriosidase) hs
HG-U95AV2:37061_AT chitinase 1 (chitotriosidase) hs
MOUSE430_2:1453844_AT chitinase 1 (chitotriosidase) mm
MOE430B:1453844_AT chitinase 1 (chitotriosidase) mm
MG-U74CV2:171513_I_AT chitinase 1 (chitotriosidase) mm
MG-U74CV2:169743_AT chitinase 1 (chitotriosidase) mm
MG-U74CV2:170265_I_AT Chitinase 1 (chitotriosidase) (Chit1), mRNA mm
RAE230B:1391761_AT chitinase 1 (chitotriosidase) (predicted) rn
RAT230_2:1391761_AT chitinase 1 (chitotriosidase) (predicted) rn
Gene Ontology
GO Biological Process (view graph)
ID Description Evidence Links
5975 carbohydrate metabolism inferred from electronic annotation QuickGO AmiGO
6030 chitin metabolism inferred from electronic annotation QuickGO AmiGO
8152 metabolism inferred from electronic annotation QuickGO AmiGO
GO Cellular Component (view graph)
ID Description Evidence Links
5576 extracellular region inferred from electronic annotation QuickGO AmiGO
GO Molecular Function (view graph)
ID Description Evidence Links
3824 catalytic activity inferred from electronic annotation QuickGO AmiGO
8061 chitin binding inferred from electronic annotation QuickGO AmiGO
16787 hydrolase activity inferred from electronic annotation QuickGO AmiGO
Protein Similarities
Method ID Description E-Value
blast AAA83586 Chitinase protein 1 [Caenorhabditis elegans] ref|NP_508588.1| CHiTinase family member (cht-1) [Caenorhabditis elegans] sp|Q11174|CHIT_CAEEL Probable endochitinase 0.0
blast CAE68422 Hypothetical protein CBG14201 [Caenorhabditis briggsae] 0.0
Protein Domains
Database ID Description E-Value
Pfam IPR001223 EMBL-EBI Glycoside hydrolase, family 18 1.0E-126
Pfam IPR002557 EMBL-EBI Chitin binding Peritrophin-A 9.4E-18
Pfam IPR002557 EMBL-EBI Chitin binding Peritrophin-A 3.3E-20
Sequence
Target Sequence
>C. ELEGANS:171912_X_AT
aaccactacaccggctttcaagtgtaccaaggatggattcttcggagttccgagtgattg
cctcaagtttatccgctgtgtgaatggtatttcatacaactttgagtgccccaacggttt
gagcttccacgctgacacaatgatgtgtgatcgtccagatccatcaaaatgtgcaaaata
agtgtattaatttccaacatctgtttaatttcacttctntgcattccttatctcctatag
cttcgttattcc


BLASTn GenBank NR
Note: "n"'s represent regions that are not probed by the probe sequences.
Probe Info
Probe Sequence(5'-3') Probe X Probe Y Probe Interrogation
Position
Strandedness
AACCACTACACCGGCTTTCAAGTGT 364 145 15 Antisense
CACCGGCTTTCAAGTGTACCAAGGA 156 201 23 Antisense
AAGGATGGATTCTTCGGAGTTCCGA 707 159 43 Antisense
GGAGTTCCGAGTGATTGCCTCAAGT 688 517 58 Antisense
TGCCTCAAGTTTATCCGCTGTGTGA 22 585 73 Antisense
TTCATACAACTTTGAGTGCCCCAAC 275 683 105 Antisense
AGCTTCCACGCTGACACAATGATGT 114 79 136 Antisense
GATGTGTGATCGTCCAGATCCATCA 350 409 156 Antisense
AAGTGTATTAATTTCCAACATCTGT 156 159 194 Antisense
CCAACATCTGTTTAATTTCACTTCT 188 277 208 Antisense
TTATCTCCTATAGCTTCGTTATTCC 26 679 242 Antisense
Sequence Source Affymetrix Proprietary Database