[Home] | [Total List]

[171901_x_at] ABC transporter

Description AV200181_rc /REP_DB=TREMBL Accession /GB=AV200181 /FEA=Transcript Cluster /DEF=Caenorhabditis elegans cDNA clone:yk558a2 : 3prime end, single read.
Cluster 6grp_highest_10_10 > 40      6grp_high1_10_10 > 03      4grp_highest_8_8 > 25      4grp_high_8_8 > 60      6grp_highest_nonorm > 12      6grp_total > 24      4grp_total > 60      6grp_highest_sub > De      6grp_cgc > 31      6grp_high1_sub > De      6grp_cgc_sub > De      6grp_total_sub > Decrease      6grp_rule_based > S1      4grp_rule_based > L3      

Scale

Warning: fopen(./gnuplot/171901_x_at_1_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/171901_x_at_1_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/171901_x_at_2_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/171901_x_at_2_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 4776
1 2 3 4 range
A 3914.6
(1.4)
P
4438.5
(2.1)
P
5161.4
(3)
P
568.3
(-3)
P
4593
B 3977.3
(1.3)
P
4137.6
(1.5)
P
5254.7
(3)
P
714.9
(-3)
P
4540
C 3427.8
(1.4)
P
3967.8
(2.2)
P
4500.9
(3)
P
479.2
(-3)
P
4022
avr 3773.2
(1.4)
4181.3
(1.9)
4972.3
(3)
587.5
(-3)
4385

Warning: fopen(./gnuplot/171901_x_at_dSignal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/171901_x_at_dSignal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 2012
1 2 3 4 5 6 range
A 3051.9
(3)
P
2649.1
(1.8)
P
1972.8
(-0.2)
P
1675.5
(-1.1)
P
1296.7
(-2.2)
P
1039.9
(-3)
P
2012
B 2999.8
(3)
P
2501.4
(1.3)
P
2066.9
(-0.2)
P
1576.5
(-1.8)
P
1236.1
(-3)
P
1292.3
(-2.8)
P
1764
C 2768.8
(3)
P
2303.6
(1.3)
P
2128
(0.7)
P
1126.1
(-3)
P
1407.6
(-2)
P
1135.7
(-3)
P
1643
avr 2940.2
(3)
2484.7
(1.5)
2055.9
(0)
1459.4
(-2)
1313.5
(-2.5)
1156
(-3)
1784
No Scale

Warning: fopen(./gnuplot/171901_x_at_1_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/171901_x_at_1_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/171901_x_at_2_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/171901_x_at_2_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 1488
1 2 3 4 range
A 1425.3
(3)
P
963.5
(0.9)
P
1349.3
(2.7)
P
83.2
(-3)
P
1342
B 1268.3
(3)
P
1021.9
(1.7)
P
1217.6
(2.7)
P
152.4
(-3)
P
1116
C 1134.7
(1.2)
P
1140.8
(1.3)
P
1568.7
(3)
P
80.8
(-3)
P
1488
avr 1276.1
(2.5)
1042.1
(1.4)
1378.5
(3)
105.5
(-3)
1273

Warning: fopen(./gnuplot/171901_x_at_dNo_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/171901_x_at_dNo_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 817
1 2 3 4 5 6 range
A 562.6
(-0.3)
P
942.1
(3)
P
429.6
(-1.5)
P
424.9
(-1.5)
P
391.3
(-1.8)
P
253.2
(-3)
P
689
B 1043.8
(3)
P
832.6
(1)
P
501.9
(-2.2)
P
417.6
(-3)
P
502.2
(-2.2)
P
481.9
(-2.4)
P
626
C 1026.3
(3)
P
702.9
(0.6)
P
541.6
(-0.6)
P
226.5
(-3)
P
455.5
(-1.3)
P
380.2
(-1.8)
P
800
avr 877.6
(3)
825.9
(2.4)
491
(-1.4)
356.3
(-3)
449.7
(-1.9)
371.8
(-2.8)
521
NetAffx Links Cluster Members
Consensus/Exemplar
Group Members
GeneChip Array Information
Probe Set ID 171901_x_at
GeneChip Array C. elegans Genome Array
Organism Common Name Nematode
Probe Design Information
Transcript ID(Array Design) affy.Ce.27643
Sequence Type Exemplar sequence
Representative Public ID AV200181 NCBI
Target Description AV200181_rc /REP_DB=TREMBL Accession /GB=AV200181 /FEA=Transcript Cluster /DEF=Caenorhabditis elegans cDNA clone:yk558a2 : 3prime end, single read.
Cluster Evidence This cluster is supported by a Transcript Cluster.
Annotation Method Description
Annotation Description This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s).
Annotation Grade This is a grade A annotation.
Annotation Transcript Cluster (# of Matching Probes) NM_001026495(11)
Transcript Assignments
Representative
Transcript
Description Matching Probes Related Probesets by Grade
NM_001026495 NCBI Caenorhabditis elegans HAlF transporter (PGP related) family member (haf-4) (haf-4) mRNA, complete cds. 11/11 None
SNAP00000040873 ENSEMBL cdna:SNAP chromosome:CEL140:I:494263:501731:1 10/11 None
GENEFINDER00000040884 ENSEMBL cdna:GeneFinder chromosome:CEL140:I:494308:496070:1 11/11 None
W04C9.1 ENSEMBL cdna:known chromosome:CEL140:I:489987:496157:1 gene:W04C9.1 11/11 A 
Annotation Notes
There are no noteworthy cross hybridizing mRNAs found for this probe set.
Genomic Alignment of Consensus/Exemplar Sequence
Assembly Wormbase March 2004
Alignment(s)
Position Identity Coverage Cytoband
chrI:494658-496093(+) 96.51 96.51
Public Domain and Genome References
Gene Title ABC transporter
Gene Symbol haf-4
Ensembl W04C9.1
Entrez Gene 171639 Entrez gene
SwissProt Q9TZD9 EMBL-EBI
WormBase CE28355 Wormbase
Functional Annotations
Gene Ontology
GO Biological Process (view graph)
ID Description Evidence Links
6810 transport inferred from electronic annotation QuickGO AmiGO
GO Cellular Component (view graph)
ID Description Evidence Links
16020 membrane inferred from electronic annotation QuickGO AmiGO
16021 integral to membrane inferred from electronic annotation QuickGO AmiGO
GO Molecular Function (view graph)
ID Description Evidence Links
166 nucleotide binding inferred from electronic annotation QuickGO AmiGO
5524 ATP binding inferred from electronic annotation QuickGO AmiGO
Protein Similarities
Method ID Description E-Value
blast AAC68724 Half transporter (pgp related) protein 4 [Caenorhabditis elegans] ref|NP_001021666.1| HAlF transporter (PGP related) family member (haf-4) [Caenorhabditis elegans] 0.0
blast CAE74830 Hypothetical protein CBG22668 [Caenorhabditis briggsae] 0.0
blast AAK39394 Half transporter (pgp related) protein 9, isoform a [Caenorhabditis elegans] ref|NP_491754.1| HAlF transporter (PGP related) family member (haf-9) [Caenorhabditis elegans] 0.0
blast AAC68724 Half transporter (pgp related) protein 4 [Caenorhabditis elegans] ref|NP_001021666.1| HAlF transporter (PGP related) family member (haf-4) [Caenorhabditis elegans] 1.0E-103
blast CAE74830 Hypothetical protein CBG22668 [Caenorhabditis briggsae] 7.0E-99
blast AAC68724 Half transporter (pgp related) protein 4 [Caenorhabditis elegans] ref|NP_001021666.1| HAlF transporter (PGP related) family member (haf-4) [Caenorhabditis elegans] 5.0E-96
blast CAE74830 Hypothetical protein CBG22668 [Caenorhabditis briggsae] 4.0E-91
Protein Domains
Database ID Description E-Value
Pfam IPR003439 EMBL-EBI ABC transporter 1.1E-39
Pfam IPR003439 EMBL-EBI ABC transporter 8.0E-35
Pfam IPR001140 EMBL-EBI ABC transporter, transmembrane region 8.6E-44
Pfam IPR003439 EMBL-EBI ABC transporter 5.1E-59
Trans Membrane
ID Number Of Domains Domain Boundaries
NP_001021666.1 9 7-29,44-66,87-106,116-138,180-202,222-244,294-316,320-342,404-426
W04C9.1 9 7-29,44-66,87-106,116-138,180-202,222-244,294-316,320-342,404-426
Sequence
Target Sequence
>C. ELEGANS:171901_X_AT
gattatcgactgttgagaaggctgataagattgtggttattaataagggaagagtcgaac
aaatcggaaatcacgaaaccctactgaaggacaccaacggaacctacgcgaagctcgttc
aacgccaaatgatgggagatcagaagccacgtaaacggccggcggtcgccagatcgggac
ctcagccagccgcgtcaatcaacgtggcaggaccatcgcagggtaatgcaatgtccctgt
tgtcgacgtctttcagccaatctgccagtagtgttacttc


BLASTn GenBank NR
Probe Info
Probe Sequence(5'-3') Probe X Probe Y Probe Interrogation
Position
Strandedness
GATTATCGACTGTTGAGAAGGCTGA 539 429 17 Antisense
AATCGGAAATCACGAAACCCTACTG 107 161 78 Antisense
GAAACCCTACTGAAGGACACCAACG 548 355 91 Antisense
ACACCAACGGAACCTACGCGAAGCT 600 99 107 Antisense
GCGAAGCTCGTTCAACGCCAAATGA 250 289 124 Antisense
TCAGAAGCCACGTAAACGGCCGGCG 501 611 156 Antisense
CCAGCCGCGTCAATCAACGTGGCAG 589 273 202 Antisense
TCAACGTGGCAGGACCATCGCAGGG 347 629 215 Antisense
GTAATGCAATGTCCCTGTTGTCGAC 13 463 239 Antisense
GTCTTTCAGCCAATCTGCCAGTAGT 549 467 264 Antisense
GCCAATCTGCCAGTAGTGTTACTTC 75 279 272 Antisense
Sequence Source Affymetrix Proprietary Database