[Home] | [Total List]

[171897_x_at] erp72

Description CEC9703_rc /REP_DB=TREMBL Accession /GB=C10970 /FEA=Transcript Cluster /DEF=C.elegans cDNA clone yk161d9 : 3prime end, single read.
Cluster 6grp_highest_10_10 > 50      6grp_high1_10_10 > 06      4grp_highest_8_8 > 09      4grp_high_8_8 > 61      6grp_highest_nonorm > 40      6grp_total > 07      4grp_total > 58      6grp_highest_sub > De      6grp_high1_sub > De      6grp_total_sub > Decrease      4grp_rule_based > L3      

Scale

Warning: fopen(./gnuplot/171897_x_at_1_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/171897_x_at_1_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/171897_x_at_2_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/171897_x_at_2_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 706
1 2 3 4 range
A 618.6
(1.2)
P
772.9
(3)
P
735.8
(2.6)
P
249.7
(-3)
P
523
B 463.5
(-2.3)
P
808.2
(1.4)
P
955.6
(3)
P
398.3
(-3)
P
557
C 645.8
(0.7)
P
783.3
(2.7)
P
801.3
(3)
P
392.8
(-3)
P
408
avr 576
(-0.2)
788.1
(2.5)
830.9
(3)
346.9
(-3)
484

Warning: fopen(./gnuplot/171897_x_at_dSignal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/171897_x_at_dSignal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 727
1 2 3 4 5 6 range
A 707.9
(3)
P
547.2
(0.6)
P
623.8
(1.7)
P
486.8
(-0.3)
P
304.4
(-3)
P
350.6
(-2.3)
P
404
B 1031.2
(3)
P
621
(-0.7)
P
796.2
(0.9)
P
455.2
(-2.2)
P
368.3
(-3)
P
460.6
(-2.2)
P
663
C 951.8
(3)
P
548.2
(-1.2)
P
520
(-1.5)
P
379
(-3)
P
504.7
(-1.7)
P
390
(-2.9)
P
573
avr 897
(3)
572.1
(-0.9)
646.7
(0)
440.3
(-2.4)
392.5
(-3)
400.4
(-2.9)
505
No Scale

Warning: fopen(./gnuplot/171897_x_at_1_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/171897_x_at_1_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/171897_x_at_2_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/171897_x_at_2_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 243
1 2 3 4 range
A 225.2
(3)
P
167.8
(1.2)
P
192.3
(2)
P
36.5
(-3)
P
189
B 147.8
(-0.2)
P
199.6
(2)
P
221.4
(3)
P
84.9
(-3)
P
137
C 213.8
(1.2)
P
225.2
(1.5)
P
279.3
(3)
P
66.2
(-3)
P
213
avr 195.6
(1.7)
197.5
(1.8)
231
(3)
62.5
(-3)
169

Warning: fopen(./gnuplot/171897_x_at_dNo_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/171897_x_at_dNo_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 283
1 2 3 4 5 6 range
A 130.5
(-0.5)
P
194.6
(3)
P
135.9
(-0.2)
P
123.5
(-0.9)
P
91.9
(-2.6)
P
85.4
(-3)
P
109
B 358.8
(3)
P
206.7
(-0.8)
P
193.3
(-1.2)
P
120.6
(-3)
P
149.6
(-2.3)
P
171.8
(-1.7)
P
238
C 352.8
(3)
P
167.3
(-1)
P
132.3
(-1.8)
P
76.2
(-3)
P
163.3
(-1.1)
P
130.6
(-1.8)
P
277
avr 280.7
(3)
189.5
(-0.1)
153.8
(-1.4)
106.8
(-3)
134.9
(-2)
129.3
(-2.2)
174
NetAffx Links Cluster Members
Consensus/Exemplar
Group Members
GeneChip Array Information
Probe Set ID 171897_x_at
GeneChip Array C. elegans Genome Array
Organism Common Name Nematode
Probe Design Information
Transcript ID(Array Design) affy.Ce.28057
Sequence Type Exemplar sequence
Representative Public ID CEC9703 NCBI
Target Description CEC9703_rc /REP_DB=TREMBL Accession /GB=C10970 /FEA=Transcript Cluster /DEF=C.elegans cDNA clone yk161d9 : 3prime end, single read.
Cluster Evidence This cluster is supported by a Transcript Cluster.
Annotation Method Description
Annotation Description This probe set was annotated using the Genome Target Overlap based pipeline to a RefSeq identifier using 1 transcript(s).
Annotation Grade This is a grade B annotation.
Annotation Transcript Cluster (# of Matching Probes) NM_066374
Transcript Assignments
Representative
Transcript
Description Matching Probes Related Probesets by Grade
GENEFINDER00000018775 ENSEMBL cdna:GeneFinder chromosome:CEL140:III:8130786:8136324:1 None
SNAP00000018771 ENSEMBL cdna:SNAP chromosome:CEL140:III:8133598:8136324:1 None
NM_066374 NCBI Caenorhabditis elegans C14B9.2 (erp72) mRNA, complete cds. A 
C14B9.2.2 ENSEMBL cdna:known chromosome:CEL140:III:8133584:8136569:1 gene:C14B9.2 A 
C14B9.2.1 ENSEMBL cdna:known chromosome:CEL140:III:8133585:8136569:1 gene:C14B9.2 A 
Annotation Notes
There are no noteworthy cross hybridizing mRNAs found for this probe set.
Genomic Alignment of Consensus/Exemplar Sequence
Assembly Wormbase March 2004
Alignment(s)
Position Identity Coverage Cytoband
chrIII:8135635-8136489(+) 86.32 86.32
Public Domain and Genome References
Gene Title erp72
Ensembl C14B9.2
Entrez Gene 176147 Entrez gene
SwissProt P34329 EMBL-EBI
WormBase CE30601 Wormbase
Functional Annotations
Ortholog
ID Title Organism
ATH1-121501:262504_AT protein disulfide isomerase, putative at
ATGENOME1:15976_AT protein disulfide isomerase, putative at
CANINE:1584019_AT similar to Protein disulfide-isomerase A4 precursor (Protein ERp-72) (ERp72) cfa
CANINE_2:CFA.4275.2.S1_AT similar to Protein disulfide-isomerase A4 precursor (Protein ERp-72) (ERp72) cfa
CANINE_2:CFAAFFX.6054.1.S1_AT similar to Protein disulfide-isomerase A4 precursor (Protein ERp-72) (ERp72) cfa
CANINE_2:CFAAFFX.6054.1.S1_S_AT similar to Protein disulfide-isomerase A4 precursor (Protein ERp-72) (ERp72) cfa
CHICKEN:GGAAFFX.12367.1.S1_AT protein disulfide isomerase family A, member 4 gga
CHICKEN:GGAAFFX.12367.1.S1_S_AT protein disulfide isomerase family A, member 4 gga
HG-U133_PLUS_2:208658_AT protein disulfide isomerase family A, member 4 hs
HG-U133A_2:208658_AT protein disulfide isomerase family A, member 4 hs
HG-U133A:208658_AT protein disulfide isomerase family A, member 4 hs
HG-FOCUS:208658_AT protein disulfide isomerase family A, member 4 hs
HG-U133A:211048_S_AT protein disulfide isomerase family A, member 4 hs
HG-U133_PLUS_2:211048_S_AT protein disulfide isomerase family A, member 4 hs
HG-U133A_2:211048_S_AT protein disulfide isomerase family A, member 4 hs
U133_X3P:G13623480_3P_S_AT protein disulfide isomerase family A, member 4 hs
U133_X3P:G12653312_3P_AT protein disulfide isomerase family A, member 4 hs
HG-U95AV2:39113_AT protein disulfide isomerase family A, member 4 hs
MU11KSUBA:J05186_S_AT protein disulfide isomerase associated 4 mm
MG-U74AV2:95423_AT protein disulfide isomerase associated 4 mm
MOE430A:1416497_AT protein disulfide isomerase associated 4 mm
MOUSE430A_2:1416497_AT protein disulfide isomerase associated 4 mm
MOUSE430_2:1416497_AT protein disulfide isomerase associated 4 mm
MU19KSUBA:TC24722_S_AT Protein disulfide isomerase associated 4 (Pdia4), mRNA mm
MU19KSUBC:TC40341_S_AT Protein disulfide isomerase associated 4 (Pdia4), mRNA mm
RT-U34:M86870_AT protein disulfide isomerase related protein (calcium-binding protein, intestinal-related) rn
RG-U34A:M86870_AT protein disulfide isomerase related protein (calcium-binding protein, intestinal-related) rn
RG-U34B:RC_AI045710_AT protein disulfide isomerase related protein (calcium-binding protein, intestinal-related) rn
RAE230A:1370007_AT protein disulfide isomerase related protein (calcium-binding protein, intestinal-related) rn
RAT230_2:1370007_AT protein disulfide isomerase related protein (calcium-binding protein, intestinal-related) rn
RAE230B:1378532_AT Protein disulfide isomerase related protein (calcium-binding protein, intestinal-related) rn
RAT230_2:1378532_AT Protein disulfide isomerase related protein (calcium-binding protein, intestinal-related) rn
Gene Ontology
GO Biological Process (view graph)
ID Description Evidence Links
6118 electron transport inferred from electronic annotation QuickGO AmiGO
GO Cellular Component (view graph)
ID Description Evidence Links
5783 endoplasmic reticulum inferred from electronic annotation QuickGO AmiGO
GO Molecular Function (view graph)
ID Description Evidence Links
5489 electron transporter activity inferred from electronic annotation QuickGO AmiGO
16853 isomerase activity inferred from electronic annotation QuickGO AmiGO
Protein Similarities
Method ID Description E-Value
blast AAM22024 Hypothetical protein C14B9.2 [Caenorhabditis elegans] ref|NP_498775.2| C14B9.2 [Caenorhabditis elegans] sp|P34329|PDIA4_CAEEL Probable protein disulfide-isomerase A4 precursor (ERp-72 homolog) 0.0
blast CAE70206 Hypothetical protein CBG16681 [Caenorhabditis briggsae] 0.0
Protein Domains
Database ID Description E-Value
Pfam IPR006662 EMBL-EBI Thioredoxin type domain 1.6E-50
Pfam IPR006662 EMBL-EBI Thioredoxin type domain 6.7E-54
Pfam IPR006662 EMBL-EBI Thioredoxin type domain 3.6E-49
Pfam IPR006662 EMBL-EBI Thioredoxin type domain 1.6E-50
Pfam IPR006662 EMBL-EBI Thioredoxin type domain 6.7E-54
Pfam IPR006662 EMBL-EBI Thioredoxin type domain 3.6E-49
Pfam IPR006662 EMBL-EBI Thioredoxin type domain 1.6E-50
Pfam IPR006662 EMBL-EBI Thioredoxin type domain 6.7E-54
Pfam IPR006662 EMBL-EBI Thioredoxin type domain 3.6E-49
Sequence
Target Sequence
>C. ELEGANS:171897_X_AT
gctccaacccagttcgcagttgaaggcttcccaactatctactttgctccacctggaaag
aagagtgagccaatcaaatattctggaaatcgtgatttggaagatctcaagaagttcatg
accaaccacggtgtgaagtcgttccagaagaaggacgagttgtaaacaattcagaaggag
caataattctgtgatatt


BLASTn GenBank NR
Probe Info
Probe Sequence(5'-3') Probe X Probe Y Probe Interrogation
Position
Strandedness
GCTCCAACCCAGTTCGCAGTTGAAG 81 299 27 Antisense
ACCCAGTTCGCAGTTGAAGGCTTCC 588 89 33 Antisense
GTTGAAGGCTTCCCAACTATCTACT 557 437 45 Antisense
ATCTACTTTGCTCCACCTGGAAAGA 446 31 63 Antisense
GAGTGAGCCAATCAAATATTCTGGA 136 401 89 Antisense
GAAATCGTGATTTGGAAGATCTCAA 678 361 112 Antisense
GATCTCAAGAAGTTCATGACCAACC 596 419 129 Antisense
GAAGTTCATGACCAACCACGGTGTG 351 337 137 Antisense
CAACCACGGTGTGAAGTCGTTCCAG 255 187 149 Antisense
GTGAAGTCGTTCCAGAAGAAGGACG 164 471 159 Antisense
GAAGGAGCAATAATTCTGTGATATT 198 335 200 Antisense
Sequence Source Affymetrix Proprietary Database