[Home] | [Total List]

[171896_x_at] --- /// --- /// ---

Description CEC5753_rc /REP_DB=TREMBL Accession /GB=C10575 /FEA=Transcript Cluster /DEF=C.elegans cDNA clone yk149d3 : 3prime end, single read.
Cluster 6grp_total > 99      4grp_total > 03      6grp_total_sub > Increase      6grp_rule_based > S6      

Scale

Warning: fopen(./gnuplot/171896_x_at_1_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/171896_x_at_1_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/171896_x_at_2_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/171896_x_at_2_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 107
1 2 3 4 range
A 23.5
(-3)
A
25.8
(-2.8)
A
48.2
(-0.3)
A
79.3
(3)
A
56
B 70.7
(-0.8)
A
35.8
(-3)
A
47.6
(-2.2)
A
130
(3)
A
94
C 55.9
(1.7)
A
63.7
(2.8)
A
23.7
(-3)
A
64.8
(3)
A
41
avr 50
(-1.8)
41.8
(-2.8)
39.8
(-3)
91.4
(3)
52

Warning: fopen(./gnuplot/171896_x_at_dSignal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/171896_x_at_dSignal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 208
1 2 3 4 5 6 range
A 56.8
(-2.3)
A
35.9
(-3)
A
82.9
(-1.4)
M
62.5
(-2.1)
A
146.2
(0.7)
P
214.3
(3)
P
178
B 49.1
(-2.2)
A
29.3
(-3)
A
39.6
(-2.6)
A
57.8
(-1.9)
A
182.8
(3)
P
182.6
(3)
P
154
C 27.5
(-2.3)
A
56
(-1.4)
P
6.3
(-3)
A
62.8
(-1.1)
M
188.2
(3)
P
161.9
(2.1)
P
182
avr 44.5
(-2.8)
40.4
(-3)
42.9
(-2.9)
61
(-2.2)
172.4
(2.4)
186.3
(3)
146
No Scale

Warning: fopen(./gnuplot/171896_x_at_1_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/171896_x_at_1_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/171896_x_at_2_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/171896_x_at_2_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 22
1 2 3 4 range
A 8.6
(-0.4)
A
5.6
(-3)
A
12.6
(3)
A
11.6
(2.1)
A
7
B 22.6
(1.4)
A
8.8
(-3)
A
11
(-2.3)
A
27.7
(3)
A
19
C 18.5
(3)
A
18.3
(2.9)
A
8.3
(-3)
A
10.9
(-1.5)
A
10
avr 16.6
(2.9)
10.9
(-2.7)
10.6
(-3)
16.7
(3)
6

Warning: fopen(./gnuplot/171896_x_at_dNo_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/171896_x_at_dNo_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 73
1 2 3 4 5 6 range
A 10.5
(-3)
A
12.8
(-2.7)
A
18.1
(-1.9)
M
15.8
(-2.2)
A
44.1
(1.8)
P
52.2
(3)
P
42
B 17.1
(-2.3)
A
9.7
(-3)
A
9.6
(-3)
A
15.3
(-2.5)
A
74.3
(3)
P
68.1
(2.4)
P
65
C 10.2
(-2.1)
A
17.1
(-1.4)
P
1.6
(-3)
A
12.6
(-1.9)
M
60.9
(3)
P
54.2
(2.3)
P
59
avr 12.6
(-2.7)
13.2
(-2.6)
9.8
(-3)
14.6
(-2.4)
59.8
(3)
58.2
(2.8)
50
NetAffx Links Cluster Members
Consensus/Exemplar
Group Members
GeneChip Array Information
Probe Set ID 171896_x_at
GeneChip Array C. elegans Genome Array
Organism Common Name Nematode
Probe Design Information
Transcript ID(Array Design) affy.Ce.27672
Sequence Type Exemplar sequence
Representative Public ID CEC5753 NCBI
Target Description CEC5753_rc /REP_DB=TREMBL Accession /GB=C10575 /FEA=Transcript Cluster /DEF=C.elegans cDNA clone yk149d3 : 3prime end, single read.
Cluster Evidence This cluster is supported by a Transcript Cluster.
Annotation Method Description
Annotation Description This probe set was annotated using the Genome Target Overlap based pipeline to a RefSeq identifier using 1 transcript(s).
Annotation Grade This is a grade B annotation.
Annotation Transcript Cluster (# of Matching Probes) NM_069410, NM_069412, NM_069407
Transcript Assignments
Representative
Transcript
Description Matching Probes Related Probesets by Grade
GENEFINDER00000020520 ENSEMBL cdna:GeneFinder chromosome:CEL140:IV:10035610:10035939:1 None
F44D12.3 ENSEMBL cdna:known chromosome:CEL140:IV:10022321:10022650:-1 gene:F44D12.3 A 
F44D12.5 ENSEMBL cdna:known chromosome:CEL140:IV:10029055:10029384:1 gene:F44D12.5 A 
GENEFINDER00000020527 ENSEMBL cdna:GeneFinder chromosome:CEL140:IV:10029055:10029384:1 None
GENEFINDER00000020526 ENSEMBL cdna:GeneFinder chromosome:CEL140:IV:10022321:10022650:-1 None
NM_069407 NCBI Caenorhabditis elegans F44D12.3 (F44D12.3) mRNA, complete cds. A 
C35D10.11 ENSEMBL cdna:known chromosome:CEL140:III:4868375:4868704:-1 gene:C35D10.11 A 
NM_069412 NCBI Caenorhabditis elegans F44D12.7 (F44D12.7) mRNA, complete cds. A 
F44D12.7 ENSEMBL cdna:known chromosome:CEL140:IV:10035610:10035939:1 gene:F44D12.7 A 
SNAP00000029549 ENSEMBL cdna:SNAP chromosome:CEL140:III:4868375:4868704:-1 None
GENEFINDER00000029561 ENSEMBL cdna:GeneFinder chromosome:CEL140:III:4868375:4868704:-1 None
NM_069410 NCBI Caenorhabditis elegans F44D12.5 (F44D12.5) mRNA, complete cds. A 
SNAP00000020512 ENSEMBL cdna:SNAP chromosome:CEL140:IV:10022321:10022650:-1 None
SNAP00000020515 ENSEMBL cdna:SNAP chromosome:CEL140:IV:10029055:10029384:1 None
SNAP00000020518 ENSEMBL cdna:SNAP chromosome:CEL140:IV:10035610:10035939:1 None
Annotation Notes
Cross Hybridizing mRNA Matched Probes Nature of Assignment Related Probesets by Grade
NM_065614 2/11 Cross Hyb Matching Probes A 
Genomic Alignment of Consensus/Exemplar Sequence
Assembly Wormbase March 2004
Alignment(s)
Position Identity Coverage Cytoband
chrIV:10029105-10029433(+) 88.62 88.62
Public Domain and Genome References
Gene Title


Ensembl C35D10.11
F44D12.3
F44D12.5
F44D12.7
Entrez Gene 177863 Entrez gene
177866 Entrez gene
260109 Entrez gene
SwissProt Q27317 EMBL-EBI
WormBase CE01192 Wormbase
CE01192 Wormbase
CE01192 Wormbase
Functional Annotations
Gene Ontology
GO Molecular Function (view graph)
ID Description Evidence Links
5198 structural molecule activity inferred from electronic annotation QuickGO AmiGO
Protein Similarities
Method ID Description E-Value
blast CAA92603 Hypothetical protein F44D12.7 [Caenorhabditis elegans] emb|CAA92601.1| Hypothetical protein F44D12.5 [Caenorhabditis elegans] emb|CAA92599.1| Hypothetical protein F44D12.3 [Caenorhabditis elegans] ref|NP_501811.1| F44D12.5 [Caenorhabditis elegans] ref|NP_501813.1| F44D12.7 [Caenorhabditis elegans] ref|NP_501808.1| F44D12.3 [Caenorhabditis elegans] ref|NP_498015.1| C35D10.11 [Caenorhabditis elegans] gb|AAA62567.1| Hypothetical protein C35D10.11 [Caenorhabditis elegans] 7.0E-43
Protein Domains
Database ID Description E-Value
Pfam IPR000535 EMBL-EBI Major sperm protein (MSP) domain 1.7E-32
Sequence
Target Sequence
>C. ELEGANS:171896_X_AT
tccacccacaacttgtcaaatgctggagctgagaagattgattcttccaagatcaagtct
tcaaccaacaacgagtaccgctatcacaccggtctttggagtcgttgatccatccggttc
caaggacatcacaatcactcgtactgctggagcaccaaaagaagacaagcttgttgttca
cgttgccgctgctccggctgattcaactgatgcccaactctncgttttcttccatcaccc
cagctgatccatcacaattccaatgtcggcaacggcttaga


BLASTn GenBank NR
Note: "n"'s represent regions that are not probed by the probe sequences.
Probe Info
Probe Sequence(5'-3') Probe X Probe Y Probe Interrogation
Position
Strandedness
TCCACCCACAACTTGTCAAATGCTG 426 589 23 Antisense
AGATCAAGTCTTCAACCAACAACGA 275 65 72 Antisense
CCAACAACGAGTACCGCTATCACAC 646 275 87 Antisense
ATCACACCGGTCTTTGGAGTCGTTG 690 27 105 Antisense
GATCCATCCGGTTCCAAGGACATCA 411 415 129 Antisense
AAGGACATCACAATCACTCGTACTG 655 159 144 Antisense
TCACTCGTACTGCTGGAGCACCAAA 309 627 157 Antisense
GACAAGCTTGTTGTTCACGTTGCCG 537 363 186 Antisense
GCTCCGGCTGATTCAACTGATGCCC 112 299 213 Antisense
GCTGATCCATCACAATTCCAATGTC 10 297 265 Antisense
ATTCCAATGTCGGCAACGGCTTAGA 175 5 279 Antisense
Sequence Source Affymetrix Proprietary Database