[Home] | [Total List]

[171858_x_at] DNA replication factor

Description CEC762_rc /REP_DB=TREMBL Accession /GB=C07762 /FEA=Transcript Cluster /DEF=C.elegans cDNA clone yk158d12 : 3prime end, single read.
Cluster 6grp_total > 88      4grp_total > 33      6grp_cgc > 59      6grp_cgc_sub > Da      6grp_total_sub > Increase      6grp_rule_based > S6      

Scale

Warning: fopen(./gnuplot/171858_x_at_1_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/171858_x_at_1_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/171858_x_at_2_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/171858_x_at_2_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 88
1 2 3 4 range
A 56
(-3)
A
143.7
(3)
P
90.9
(-0.6)
A
139
(2.7)
A
88
B 63.3
(-3)
A
67.3
(-2.6)
A
117.5
(3)
P
91
(0.1)
A
54
C 62.6
(-3)
M
108.6
(3)
A
77.7
(-1)
A
93.2
(1)
A
46
avr 60.6
(-3)
106.5
(2.8)
95.4
(1.4)
107.7
(3)
47

Warning: fopen(./gnuplot/171858_x_at_dSignal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/171858_x_at_dSignal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 106
1 2 3 4 5 6 range
A 38.1
(-2.5)
P
33.3
(-3)
A
45.1
(-1.8)
P
33.2
(-3)
A
92.8
(3)
P
91.6
(2.9)
P
60
B 29.8
(-3)
A
38.1
(-2.5)
A
31.5
(-2.9)
A
57.5
(-1.4)
A
96.2
(0.8)
A
135.4
(3)
A
106
C 67.2
(0.5)
A
49
(-1.6)
A
44.9
(-2.1)
A
44
(-2.2)
A
36.6
(-3)
A
89.5
(3)
P
53
avr 45
(-2.6)
40.1
(-3)
40.5
(-3)
44.9
(-2.6)
75.2
(0.2)
105.5
(3)
65
No Scale

Warning: fopen(./gnuplot/171858_x_at_1_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/171858_x_at_1_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/171858_x_at_2_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/171858_x_at_2_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 16
1 2 3 4 range
A 20.4
(-3)
A
31.2
(3)
P
23.8
(-1.1)
A
20.4
(-3)
A
11
B 20.2
(-1)
A
16.6
(-3)
A
27.2
(3)
P
19.4
(-1.4)
A
11
C 20.7
(-1.1)
M
31.2
(3)
A
27.1
(1.4)
A
15.7
(-3)
A
16
avr 20.4
(-1.5)
26.3
(3)
26
(2.8)
18.5
(-3)
8

Warning: fopen(./gnuplot/171858_x_at_dNo_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/171858_x_at_dNo_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 44
1 2 3 4 5 6 range
A 7
(-3)
P
11.8
(-1.6)
A
9.8
(-2.2)
P
8.4
(-2.6)
A
28
(3)
P
22.3
(1.4)
P
21
B 10.4
(-2.6)
A
12.7
(-2.3)
A
7.7
(-3)
A
15.2
(-1.9)
A
39.1
(1.4)
A
50.5
(3)
A
43
C 24.9
(1.6)
A
14.9
(-1.3)
A
11.4
(-2.3)
A
8.8
(-3)
A
11.8
(-2.2)
A
30
(3)
P
21
avr 14.1
(-1.9)
13.1
(-2.1)
9.6
(-3)
10.8
(-2.7)
26.3
(1.1)
34.3
(3)
25
NetAffx Links Cluster Members
Consensus/Exemplar
Group Members
GeneChip Array Information
Probe Set ID 171858_x_at
GeneChip Array C. elegans Genome Array
Organism Common Name Nematode
Probe Design Information
Transcript ID(Array Design) affy.Ce.27707
Sequence Type Exemplar sequence
Representative Public ID CEC762 NCBI
Target Description CEC762_rc /REP_DB=TREMBL Accession /GB=C07762 /FEA=Transcript Cluster /DEF=C.elegans cDNA clone yk158d12 : 3prime end, single read.
Cluster Evidence This cluster is supported by a Transcript Cluster.
Annotation Method Description
Annotation Description This probe set was annotated using the Genome Target Overlap based pipeline to a RefSeq identifier using 1 transcript(s).
Annotation Grade This is a grade B annotation.
Annotation Transcript Cluster (# of Matching Probes) NM_067668
Transcript Assignments
Representative
Transcript
Description Matching Probes Related Probesets by Grade
NM_067668 NCBI Caenorhabditis elegans RFC (DNA replication factor) family member (rfc-2) (rfc-2) mRNA, complete cds. A 
GENEFINDER00000017988 ENSEMBL cdna:GeneFinder chromosome:CEL140:IV:1347318:1352882:1 None
F58F6.4.2 ENSEMBL cdna:known chromosome:CEL140:IV:1347314:1352882:1 gene:F58F6.4 None
F58F6.4.1 ENSEMBL cdna:known chromosome:CEL140:IV:1347316:1352956:1 gene:F58F6.4 None
Annotation Notes
There are no noteworthy cross hybridizing mRNAs found for this probe set.
Genomic Alignment of Consensus/Exemplar Sequence
Assembly Wormbase March 2004
Alignment(s)
Position Identity Coverage Cytoband
chrIV:1352770-1352926(+) 69.44 69.44
Public Domain and Genome References
Gene Title DNA replication factor
Gene Symbol rfc-2
Ensembl F58F6.4
Entrez Gene 176946 Entrez gene
SwissProt O44175 EMBL-EBI
WormBase CE17139 Wormbase
Functional Annotations
Ortholog
ID Title Organism
ATH1-121501:259690_AT replication factor C 40 kDa, putative at
CANINE_2:CFA.18363.1.S1_S_AT similar to replication factor C 2 (40kD) isoform 2 cfa
CANINE_2:CFAAFFX.18598.1.S1_S_AT similar to replication factor C 2 (40kD) isoform 2 cfa
DROSOPHILA_2:1634943_AT Replication-factor-C 40kD subunit dm
DROSGENOME1:154910_AT Replication-factor-C 40kD subunit dm
CHICKEN:GGA.883.1.S1_AT replication factor C (activator 1) 2, 40kDa gga
CHICKEN:GGA.883.2.A1_AT Replication factor C (activator 1) 2, 40kDa gga
HG-U95AV2:1053_AT replication factor C (activator 1) 2, 40kDa hs
HG-U133_PLUS_2:1053_AT replication factor C (activator 1) 2, 40kDa hs
HG-U133A_2:1053_AT replication factor C (activator 1) 2, 40kDa hs
HC-G110:1053_AT replication factor C (activator 1) 2, 40kDa hs
HG-U133A:1053_AT replication factor C (activator 1) 2, 40kDa hs
HG-FOCUS:1053_AT replication factor C (activator 1) 2, 40kDa hs
HG-U133_PLUS_2:203696_S_AT replication factor C (activator 1) 2, 40kDa hs
HG-U133A:203696_S_AT replication factor C (activator 1) 2, 40kDa hs
HG-U133A_2:203696_S_AT replication factor C (activator 1) 2, 40kDa hs
HU35KSUBD:RC_R60181_AT replication factor C (activator 1) 2, 40kDa hs
HUGENEFL:M87338_AT replication factor C (activator 1) 2, 40kDa hs
U133_X3P:G4506486_3P_X_AT replication factor C (activator 1) 2, 40kDa hs
U133_X3P:M87338_3P_X_AT replication factor C (activator 1) 2, 40kDa hs
U133_X3P:203696_3P_S_AT replication factor C (activator 1) 2, 40kDa hs
U133_X3P:1053_3P_AT replication factor C (activator 1) 2, 40kDa hs
RG-U34B:RC_AA899195_AT replication factor C (activator 1) 2 rn
RAE230A:1370910_AT replication factor C (activator 1) 2 rn
RAT230_2:1370910_AT replication factor C (activator 1) 2 rn
YEAST_2:1778831_AT Subunit of heteropentameric Replication factor C (RF-C), which is a DNA binding protein and ATPase that acts as a clamp loader of the proliferating cell nuclear antigen (PCNA) processivity factor for DNA polymerases delta and epsilon Sc
Gene Ontology
GO Molecular Function (view graph)
ID Description Evidence Links
166 nucleotide binding inferred from electronic annotation QuickGO AmiGO
Protein Similarities
Method ID Description E-Value
blast AAB88360 Rfc (dna replication factor) family protein 2 [Caenorhabditis elegans] ref|NP_500069.1| RFC (DNA replication factor) family member (rfc-2) [Caenorhabditis elegans] 0.0
blast CAE75096 Hypothetical protein CBG23018 [Caenorhabditis briggsae] 1.0E-165
blast CAE75096 Hypothetical protein CBG23018 [Caenorhabditis briggsae] 1.0E-159
blast NP_064406 replication factor C (activator 1) 2 [Mus musculus] gb|AAH23028.1| Replication factor C (activator 1) 2 [Mus musculus] gb|AAH99370.1| Replication factor C (activator 1) 2 [Mus musculus] dbj|BAE32762.1| unnamed protein product [Mus musculus] dbj|BAC36108.1| unnamed protein product [Mus musculus] gb|AAD34861.1| replication factor C, 40kDa subunit [Mus musculus] gb|AAF99332.1| RFC2 [Mus musculus] sp|Q9WUK4|RFC2_MOUSE Activator 1 40 kDa subunit (Replication factor C 40 kDa subunit) (A1 40 kDa subunit) (RF-C 40 kDa subunit) (RFC40) 1.0E-111
Sequence
Target Sequence
>C. ELEGANS:171858_X_AT
aatggagtatattcggcaaatcgccatgttccatatgcgtatcgttcagggactcacttc
gaaacttcaactctcccgtctgatttccgatctgttccgagtttcagcagcggcaacggc
tnacgagttcctaaaattgtttccgagattttcaat


BLASTn GenBank NR
Note: "n"'s represent regions that are not probed by the probe sequences.
Probe Info
Probe Sequence(5'-3') Probe X Probe Y Probe Interrogation
Position
Strandedness
AATGGAGTATATTCGGCAAATCGCC 130 163 27 Antisense
TATTCGGCAAATCGCCATGTTCCAT 58 663 36 Antisense
GCCATGTTCCATATGCGTATCGTTC 445 281 49 Antisense
TGTTCCATATGCGTATCGTTCAGGG 54 563 53 Antisense
TATGCGTATCGTTCAGGGACTCACT 661 655 60 Antisense
GTTCAGGGACTCACTTCGAAACTTC 48 443 70 Antisense
ACTCACTTCGAAACTTCAACTCTCC 537 99 78 Antisense
ATTTCCGATCTGTTCCGAGTTTCAG 597 15 109 Antisense
GTTCCGAGTTTCAGCAGCGGCAACG 645 439 120 Antisense
GAGTTCCTAAAATTGTTTCCGAGAT 54 399 151 Antisense
TAAAATTGTTTCCGAGATTTTCAAT 694 639 158 Antisense
Sequence Source Affymetrix Proprietary Database