[Home] | [Total List]

[171852_x_at]

Description CEC0893_rc /REP_DB=TREMBL Accession /GB=C11089 /FEA=Transcript Cluster /DEF=C.elegans cDNA clone yk163g7 : 3prime end, single read.
Cluster 6grp_highest_10_10 > 28      6grp_high1_10_10 > 72      6grp_highest_nonorm > 72      6grp_total > 72      4grp_total > 60      6grp_highest_sub > 04      6grp_cgc > 76      6grp_high1_sub > 04      6grp_cgc_sub > 03_04      6grp_total_sub > Hat      6grp_rule_based > S4      

Scale

Warning: fopen(./gnuplot/171852_x_at_1_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/171852_x_at_1_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/171852_x_at_2_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/171852_x_at_2_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 102
1 2 3 4 range
A 106.3
(3)
A
70.3
(-0.2)
A
99.7
(2.4)
A
38.6
(-3)
A
68
B 86.3
(2.1)
A
96.9
(2.8)
A
99.4
(3)
P
13.2
(-3)
A
86
C 88.2
(1.7)
P
84.7
(1.5)
A
110.5
(3)
P
9
(-3)
A
102
avr 93.6
(2.3)
84
(1.6)
103.2
(3)
20.3
(-3)
83

Warning: fopen(./gnuplot/171852_x_at_dSignal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/171852_x_at_dSignal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 625
1 2 3 4 5 6 range
A 93.4
(-3)
P
224.1
(-1.5)
P
584.1
(2.7)
P
608.1
(3)
P
518.6
(2)
P
226.2
(-1.5)
P
515
B 138.5
(-3)
P
274
(-1.6)
P
661.6
(2.4)
P
718.3
(3)
P
680.1
(2.6)
P
274.7
(-1.6)
P
580
C 181.4
(-3)
P
219.8
(-2.5)
P
417.9
(0.1)
P
634.6
(3)
P
593.1
(2.5)
P
326.5
(-1.1)
P
453
avr 137.8
(-3)
239.3
(-1.8)
554.5
(1.8)
653.7
(3)
597.3
(2.3)
275.8
(-1.4)
516
No Scale

Warning: fopen(./gnuplot/171852_x_at_1_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/171852_x_at_1_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/171852_x_at_2_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/171852_x_at_2_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 37
1 2 3 4 range
A 38.7
(3)
A
15.3
(-1.3)
A
26.1
(0.7)
A
5.7
(-3)
A
33
B 27.5
(3)
A
23.9
(2.1)
A
23
(1.9)
P
2.8
(-3)
A
25
C 29.2
(1.5)
P
24.3
(0.7)
A
38.5
(3)
P
1.5
(-3)
A
37
avr 31.8
(3)
21.2
(0.8)
29.2
(2.5)
3.3
(-3)
29

Warning: fopen(./gnuplot/171852_x_at_dNo_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/171852_x_at_dNo_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 259
1 2 3 4 5 6 range
A 17.2
(-3)
P
79.7
(-0.3)
P
127.2
(1.7)
P
154.2
(2.9)
P
156.5
(3)
P
55.1
(-1.4)
P
139
B 48.2
(-3)
P
91.2
(-1.9)
P
160.6
(-0)
P
190.3
(0.7)
P
276.3
(3)
P
102.4
(-1.6)
P
228
C 67.3
(-3)
P
67.1
(-3)
P
106.4
(-1.1)
P
127.6
(-0.1)
P
191.9
(3)
P
109.3
(-1)
P
125
avr 44.2
(-3)
79.3
(-1.7)
131.4
(0.2)
157.4
(1.1)
208.2
(3)
88.9
(-1.4)
164
NetAffx Links Cluster Members
Consensus/Exemplar
Group Members
GeneChip Array Information
Probe Set ID 171852_x_at
GeneChip Array C. elegans Genome Array
Organism Common Name Nematode
Probe Design Information
Transcript ID(Array Design) affy.Ce.27646
Sequence Type Exemplar sequence
Representative Public ID CEC0893 NCBI
Target Description CEC0893_rc /REP_DB=TREMBL Accession /GB=C11089 /FEA=Transcript Cluster /DEF=C.elegans cDNA clone yk163g7 : 3prime end, single read.
Cluster Evidence This cluster is supported by a Transcript Cluster.
Annotation Method Description
Annotation Description This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s).
Annotation Grade This is a grade A annotation.
Annotation Transcript Cluster (# of Matching Probes) NM_071127(9)
Transcript Assignments
Representative
Transcript
Description Matching Probes Related Probesets by Grade
NM_071127 NCBI Caenorhabditis elegans SeRPin family member (srp-3) (srp-3) mRNA, complete cds. 9/11 None
GENEFINDER00000028163 ENSEMBL cdna:GeneFinder chromosome:CEL140:V:1908737:1910798:1 9/11 None
Y32G9A.4 ENSEMBL cdna:known chromosome:CEL140:V:1908724:1910520:1 gene:Y32G9A.4 9/11 None
Annotation Notes
Cross Hybridizing mRNA Matched Probes Nature of Assignment Related Probesets by Grade
SNAP00000028148 1/11 Cross Hyb Matching Probes None
Genomic Alignment of Consensus/Exemplar Sequence
Assembly Wormbase March 2004
Alignment(s)
Position Identity Coverage Cytoband
chrV:1910089-1910434(+) 65.15 70.68
Public Domain and Genome References
Gene Title
Gene Symbol srp-3
Ensembl Y32G9A.4
Entrez Gene 178672 Entrez gene
SwissProt Q9BPM9 EMBL-EBI
WormBase CE31100 Wormbase
Functional Annotations
Ortholog
ID Title Organism
CANINE:1586600_AT similar to serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 1 cfa
CANINE_2:CFA.11134.1.A1_AT similar to serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 1 cfa
CANINE_2:CFA.20920.1.S1_S_AT similar to serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 1 cfa
DROSOPHILA_2:1632613_AT Serine protease inhibitor 6 dm
DROSGENOME1:144243_AT Serine protease inhibitor 6 dm
CHICKEN:GGAAFFX.8144.1.S1_AT similar to serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 1; protease inhibitor 2 (anti-elastase), monocyte/neutrophil; protease inhibitor 2 (anti-elastase), monocyte/neutrophil derived; anti-elastase gga
HG-U133A:212268_AT serpin peptidase inhibitor, clade B (ovalbumin), member 1 hs
HG-U133A_2:212268_AT serpin peptidase inhibitor, clade B (ovalbumin), member 1 hs
HG-U133_PLUS_2:212268_AT serpin peptidase inhibitor, clade B (ovalbumin), member 1 hs
HUGENEFL:M93056_AT serpin peptidase inhibitor, clade B (ovalbumin), member 1 hs
U133_X3P:HS.183583.1.S1_3P_A_AT serpin peptidase inhibitor, clade B (ovalbumin), member 1 hs
U133_X3P:HS.183583.0.S1_3P_X_AT serpin peptidase inhibitor, clade B (ovalbumin), member 1 hs
U133_X3P:HS.183583.0.S1_3P_A_AT serpin peptidase inhibitor, clade B (ovalbumin), member 1 hs
HG-U133A_2:213572_S_AT serpin peptidase inhibitor, clade B (ovalbumin), member 1 hs
HG-FOCUS:213572_S_AT serpin peptidase inhibitor, clade B (ovalbumin), member 1 hs
HG-U133_PLUS_2:213572_S_AT serpin peptidase inhibitor, clade B (ovalbumin), member 1 hs
HG-U133A:213572_S_AT serpin peptidase inhibitor, clade B (ovalbumin), member 1 hs
HG-U95AV2:33305_AT serpin peptidase inhibitor, clade B (ovalbumin), member 1 hs
U133_X3P:HS.191379.0.A1_3P_AT Serpin peptidase inhibitor, clade B (ovalbumin), member 1 hs
HG-U133_PLUS_2:239213_AT Serpin peptidase inhibitor, clade B (ovalbumin), member 1 hs
HG-U133B:239213_AT Serpin peptidase inhibitor, clade B (ovalbumin), member 1 hs
HG-U95E:79209_AT Serpin peptidase inhibitor, clade B (ovalbumin), member 1 hs
HG-U133_PLUS_2:228726_AT Serpin peptidase inhibitor, clade B (ovalbumin), member 1 hs
HG-U133B:228726_AT Serpin peptidase inhibitor, clade B (ovalbumin), member 1 hs
U133_X3P:HS.234392.2.A1_3P_AT Serpin peptidase inhibitor, clade B (ovalbumin), member 1 hs
MU11KSUBB:MSA.3814.0_S_AT serine (or cysteine) peptidase inhibitor, clade B, member 1a mm
MU11KSUBB:MSA.36026.0_S_AT serine (or cysteine) peptidase inhibitor, clade B, member 1a mm
MG-U74AV2:100100_AT serine (or cysteine) peptidase inhibitor, clade B, member 1a mm
MG-U74BV2:109993_AT serine (or cysteine) peptidase inhibitor, clade B, member 1a mm
MOE430A:1416318_AT serine (or cysteine) peptidase inhibitor, clade B, member 1a mm
MOUSE430A_2:1416318_AT serine (or cysteine) peptidase inhibitor, clade B, member 1a mm
MOUSE430_2:1416318_AT serine (or cysteine) peptidase inhibitor, clade B, member 1a mm
MOE430A:1448301_S_AT serine (or cysteine) peptidase inhibitor, clade B, member 1a mm
MOUSE430A_2:1448301_S_AT serine (or cysteine) peptidase inhibitor, clade B, member 1a mm
MOUSE430_2:1448301_S_AT serine (or cysteine) peptidase inhibitor, clade B, member 1a mm
MG-U74CV2:136436_AT EIA (Serpinb1) mm
MU11KSUBB:MSA.34165.0_S_AT EIA (Serpinb1) mm
MU19KSUBC:TC37779_AT EIA (Serpinb1) mm
RAE230A:1377034_AT serine (or cysteine) proteinase inhibitor, clade B, member 1a (predicted) rn
RAT230_2:1377034_AT serine (or cysteine) proteinase inhibitor, clade B, member 1a (predicted) rn
RAE230B:1380346_AT serine (or cysteine) proteinase inhibitor, clade B, member 1a (predicted) rn
RAT230_2:1380346_AT serine (or cysteine) proteinase inhibitor, clade B, member 1a (predicted) rn
RAE230A:1376258_AT Serine (or cysteine) proteinase inhibitor, clade B, member 1a (predicted) rn
RAT230_2:1376258_AT Serine (or cysteine) proteinase inhibitor, clade B, member 1a (predicted) rn
RG-U34B:RC_AA901193_AT Serine (or cysteine) proteinase inhibitor, clade B, member 1a (predicted) rn
Gene Ontology
GO Molecular Function (view graph)
ID Description Evidence Links
4867 serine-type endopeptidase inhibitor activity inferred from electronic annotation QuickGO AmiGO
Protein Similarities
Method ID Description E-Value
blast NP_503528 SeRPin family member (srp-3) [Caenorhabditis elegans] gb|AAS13529.1| serine or cysteine protease inhibitor [Caenorhabditis elegans] gb|AAM48555.1| Serpin protein 3 [Caenorhabditis elegans] 0.0
blast CAE62288 Hypothetical protein CBG06347 [Caenorhabditis briggsae] 1.0E-119
blast CAE62292 Hypothetical protein CBG06352 [Caenorhabditis briggsae] 4.0E-91
Protein Domains
Database ID Description E-Value
Pfam IPR000215 EMBL-EBI Serpin 2.1E-68
Trans Membrane
ID Number Of Domains Domain Boundaries
GENEFINDER00000028163 1 353-375
Sequence
Target Sequence
>C. ELEGANS:171852_X_AT
gaacttaaagtcccatttgcagaccttgggaatcactgatattttctctgactctgcgga
cttnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnngccgctgccgtgacgatgatgaaagcagttccggtgtc
tgcaagaatggagcaaccagtaaactttatagcagatcatccattc


BLASTn GenBank NR
Note: "n"'s represent regions that are not probed by the probe sequences.
Probe Info
Probe Sequence(5'-3') Probe X Probe Y Probe Interrogation
Position
Strandedness
GAACTTAAAGTCCCATTTGCAGACC 567 349 13 Antisense
TTAAAGTCCCATTTGCAGACCTTGG 595 683 17 Antisense
CCATTTGCAGACCTTGGGAATCACT 61 269 25 Antisense
GAATCACTGATATTTTCTCTGACTC 679 327 42 Antisense
CACTGATATTTTCTCTGACTCTGCG 294 199 46 Antisense
GCCGCTGCCGTGACGATGATGAAAG 540 285 155 Antisense
GATGATGAAAGCAGTTCCGGTGTCT 495 411 169 Antisense
AGCAGTTCCGGTGTCTGCAAGAATG 640 67 178 Antisense
GTCTGCAAGAATGGAGCAACCAGTA 449 469 190 Antisense
GGAGCAACCAGTAAACTTTATAGCA 669 519 202 Antisense
AAACTTTATAGCAGATCATCCATTC 569 127 214 Antisense
Sequence Source Affymetrix Proprietary Database