[Home] | [Total List]

[171847_s_at] Kunitz/Bovine pancreatic trypsin inhibitor domain (10 domains), Thyroglobulin type-1 repeat

Description C38618_rc /REP_DB=TREMBL Accession /GB=C38618 /FEA=Transcript Cluster /DEF=C.elegans cDNA clone yk495h12 : 3prime end, single read.
Cluster 6grp_highest_10_10 > 10      6grp_high1_10_10 > 08      4grp_highest_8_8 > 02      4grp_high_8_8 > 46      6grp_highest_nonorm > 02      6grp_total > 03      4grp_total > 49      6grp_cgc > 41      4grp_rule_based > L2      

Scale

Warning: fopen(./gnuplot/171847_s_at_1_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/171847_s_at_1_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/171847_s_at_2_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/171847_s_at_2_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 3838
1 2 3 4 range
A 86.3
(-3)
P
3813
(3)
P
3688.4
(2.8)
P
174.2
(-2.9)
P
3727
B 63.1
(-3)
P
3744.7
(3)
P
3090.7
(1.9)
P
100.6
(-2.9)
P
3682
C 62
(-3)
P
3899.8
(3)
P
3246.6
(2)
P
144.6
(-2.9)
P
3838
avr 70.5
(-3)
3819.2
(3)
3341.9
(2.2)
139.8
(-2.9)
3749

Warning: fopen(./gnuplot/171847_s_at_dSignal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/171847_s_at_dSignal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 3006
1 2 3 4 5 6 range
A 3663.8
(3)
P
2965
(1.5)
P
1841.2
(-0.9)
P
2034.9
(-0.5)
P
2442.8
(0.4)
P
853.4
(-3)
P
2810
B 3576.8
(3)
P
2633.1
(0.9)
P
1388
(-1.9)
P
3018.9
(1.7)
P
1822.2
(-0.9)
P
903.8
(-3)
P
2673
C 3282.6
(3)
P
2617.1
(1.5)
P
1825
(-0.3)
P
2488.8
(1.2)
P
2288.7
(0.7)
P
657.4
(-3)
P
2625
avr 3507.7
(3)
2738.4
(1.3)
1684.7
(-1)
2514.2
(0.8)
2184.6
(0.1)
804.9
(-3)
2703
No Scale

Warning: fopen(./gnuplot/171847_s_at_1_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/171847_s_at_1_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/171847_s_at_2_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/171847_s_at_2_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 1112
1 2 3 4 range
A 31.4
(-3)
P
827.7
(2.1)
P
964.2
(3)
P
25.5
(-3)
P
939
B 20.1
(-3)
P
924.9
(3)
P
716.2
(1.6)
P
21.4
(-3)
P
905
C 20.5
(-3)
P
1121.2
(2.9)
P
1131.6
(3)
P
24.4
(-3)
P
1111
avr 24
(-3)
957.9
(3)
937.3
(2.9)
23.8
(-3)
934

Warning: fopen(./gnuplot/171847_s_at_dNo_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/171847_s_at_dNo_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 1037
1 2 3 4 5 6 range
A 675.4
(0.3)
P
1054.5
(3)
P
401
(-1.6)
P
516.1
(-0.8)
P
737.1
(0.8)
P
207.8
(-3)
P
847
B 1244.6
(3)
P
876.5
(0.6)
P
337
(-3)
P
799.6
(0.1)
P
740.3
(-0.3)
P
337
(-3)
P
908
C 1216.7
(3)
P
798.5
(0.5)
P
464.5
(-1.5)
P
500.5
(-1.3)
P
740.6
(0.1)
P
220.1
(-3)
P
997
avr 1045.6
(3)
909.8
(2)
400.8
(-1.9)
605.4
(-0.3)
739.3
(0.7)
255
(-3)
791
NetAffx Links Cluster Members
Consensus/Exemplar
Group Members
GeneChip Array Information
Probe Set ID 171847_s_at
GeneChip Array C. elegans Genome Array
Organism Common Name Nematode
Probe Design Information
Transcript ID(Array Design) affy.Ce.27634
Sequence Type Exemplar sequence
Representative Public ID C38618 NCBI
Target Description C38618_rc /REP_DB=TREMBL Accession /GB=C38618 /FEA=Transcript Cluster /DEF=C.elegans cDNA clone yk495h12 : 3prime end, single read.
Cluster Evidence This cluster is supported by a Transcript Cluster.
Annotation Method Description
Annotation Description This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s).
Annotation Grade This is a grade A annotation.
Annotation Transcript Cluster (# of Matching Probes) NM_075592(11)
Transcript Assignments
Representative
Transcript
Description Matching Probes Related Probesets by Grade
NM_075592 NCBI Caenorhabditis elegans W01F3.3 (W01F3.3) mRNA, complete cds. 11/11 None
W01F3.3 ENSEMBL cdna:known chromosome:CEL140:V:20663308:20676528:1 gene:W01F3.3 11/11 A 
Annotation Notes
There are no noteworthy cross hybridizing mRNAs found for this probe set.
Genomic Alignment of Consensus/Exemplar Sequence
Assembly Wormbase March 2004
Alignment(s)
Position Identity Coverage Cytoband
chrV:20676257-20676480(+) 68.39 68.39
Public Domain and Genome References
Gene Title Kunitz/Bovine pancreatic trypsin inhibitor domain (10 domains), Thyroglobulin type-1 repeat
Gene Symbol mlt-11
Ensembl W01F3.3
Entrez Gene 180352 Entrez gene
SwissProt O45881 EMBL-EBI
WormBase CE16531 Wormbase
Functional Annotations
Gene Ontology
GO Molecular Function (view graph)
ID Description Evidence Links
4867 serine-type endopeptidase inhibitor activity inferred from electronic annotation QuickGO AmiGO
Protein Similarities
Method ID Description E-Value
blast CAB07294 Hypothetical protein W01F3.3 [Caenorhabditis elegans] ref|NP_507993.1| W01F3.3 [Caenorhabditis elegans] 0.0
blast CAE61690 Hypothetical protein CBG05636 [Caenorhabditis briggsae] 0.0
blast AAN10061 Kunitz-like protease inhibitor precursor [Ancylostoma caninum] 2.0E-67
Protein Domains
Database ID Description E-Value
Pfam IPR000716 EMBL-EBI Thyroglobulin type-1 3.0E-18
Pfam IPR002223 EMBL-EBI Pancreatic trypsin inhibitor (Kunitz) 1.6E-23
Pfam IPR002223 EMBL-EBI Pancreatic trypsin inhibitor (Kunitz) 2.6E-27
Pfam IPR002223 EMBL-EBI Pancreatic trypsin inhibitor (Kunitz) 6.1E-28
Pfam IPR002223 EMBL-EBI Pancreatic trypsin inhibitor (Kunitz) 7.0E-25
Pfam IPR002223 EMBL-EBI Pancreatic trypsin inhibitor (Kunitz) 1.0E-26
Pfam IPR002223 EMBL-EBI Pancreatic trypsin inhibitor (Kunitz) 4.9E-28
Pfam IPR002223 EMBL-EBI Pancreatic trypsin inhibitor (Kunitz) 2.0E-26
Pfam IPR002223 EMBL-EBI Pancreatic trypsin inhibitor (Kunitz) 3.4E-21
Pfam IPR002223 EMBL-EBI Pancreatic trypsin inhibitor (Kunitz) 9.8E-30
Pfam IPR002223 EMBL-EBI Pancreatic trypsin inhibitor (Kunitz) 1.3E-16
Sequence
Target Sequence
>C. ELEGANS:171847_S_AT
tccttgactgattgatatttcttccaaagttgccaagccttaatttntacgttgtacgnn
nnnnnncacaaatccacaaaattgtatatttattttctctgtaactttgctcctgggctc
agccatccctaataatatgtat


BLASTn GenBank NR
Note: "n"'s represent regions that are not probed by the probe sequences.
Probe Info
Probe Sequence(5'-3') Probe X Probe Y Probe Interrogation
Position
Strandedness
TCCTTGACTGATTGATATTTCTTCC 590 591 142 Antisense
CCTTGACTGATTGATATTTCTTCCA 561 269 143 Antisense
TTGACTGATTGATATTTCTTCCAAA 549 703 145 Antisense
GACTGATTGATATTTCTTCCAAAGT 708 375 147 Antisense
CTGATTGATATTTCTTCCAAAGTTG 220 239 149 Antisense
CTTCCAAAGTTGCCAAGCCTTAATT 268 219 162 Antisense
TTCCAAAGTTGCCAAGCCTTAATTT 294 699 163 Antisense
TTATTTTCTCTGTAACTTTGCTCCT 174 679 231 Antisense
TGGGCTCAGCCATCCCTAATAATAT 184 553 255 Antisense
GGCTCAGCCATCCCTAATAATATGT 97 539 257 Antisense
CTCAGCCATCCCTAATAATATGTAT 313 229 259 Antisense
Sequence Source Affymetrix Proprietary Database