[Home] | [Total List]

[171793_x_at] beta tubulin

Description C35942_rc /REP_DB=TREMBL Accession /GB=C35942 /FEA=Transcript Cluster /DEF=C.elegans cDNA clone yk450h7 : 3prime end, single read.
Cluster 6grp_total > 05      4grp_total > 54      6grp_cgc > 22      6grp_cgc_sub > De      6grp_rule_based > S1      4grp_rule_based > L1      

Scale

Warning: fopen(./gnuplot/171793_x_at_1_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/171793_x_at_1_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/171793_x_at_2_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/171793_x_at_2_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 319
1 2 3 4 range
A 309.7
(3)
P
245.5
(0.5)
A
205.9
(-1)
A
155.8
(-3)
A
154
B 375.3
(3)
P
211.8
(-0.5)
A
184.7
(-1.1)
A
96.8
(-3)
A
279
C 256.8
(3)
P
209.3
(1.6)
A
205.6
(1.5)
A
56.3
(-3)
A
201
avr 313.9
(3)
222.2
(0.4)
198.7
(-0.3)
103
(-3)
211

Warning: fopen(./gnuplot/171793_x_at_dSignal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/171793_x_at_dSignal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 339
1 2 3 4 5 6 range
A 270.1
(3)
P
179.7
(0.8)
M
128.6
(-0.5)
A
134
(-0.3)
A
104
(-1.1)
A
25.3
(-3)
A
245
B 364.5
(3)
P
247.3
(0.7)
P
137.1
(-1.5)
A
61.3
(-3)
A
156.1
(-1.1)
A
93.2
(-2.4)
A
303
C 323.4
(3)
P
286.3
(2.2)
P
94.3
(-1.6)
A
26.8
(-3)
A
86.6
(-1.8)
A
77
(-2)
A
297
avr 319.3
(3)
237.8
(1.1)
120
(-1.7)
74
(-2.8)
115.6
(-1.8)
65.2
(-3)
254
No Scale

Warning: fopen(./gnuplot/171793_x_at_1_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/171793_x_at_1_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/171793_x_at_2_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/171793_x_at_2_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 110
1 2 3 4 range
A 112.7
(3)
P
53.3
(-1)
A
53.8
(-0.9)
A
22.8
(-3)
A
90
B 119.7
(3)
P
52.3
(-1.1)
A
42.8
(-1.7)
A
20.6
(-3)
A
99
C 85
(3)
P
60.2
(1)
A
71.7
(1.9)
A
9.5
(-3)
A
76
avr 105.8
(3)
55.3
(-0.4)
56.1
(-0.4)
17.6
(-3)
88

Warning: fopen(./gnuplot/171793_x_at_dNo_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/171793_x_at_dNo_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 121
1 2 3 4 5 6 range
A 49.8
(1.5)
P
63.9
(3)
M
28
(-0.7)
A
34
(-0.1)
A
31.4
(-0.4)
A
6.2
(-3)
A
58
B 126.8
(3)
P
82.3
(0.6)
P
33.3
(-2.1)
A
16.2
(-3)
A
63.4
(-0.4)
A
34.7
(-2)
A
111
C 119.9
(3)
P
87.3
(1.3)
P
24
(-2)
A
5.4
(-3)
A
28
(-1.8)
A
25.8
(-1.9)
A
115
avr 98.8
(3)
77.8
(1.4)
28.4
(-2.3)
18.5
(-3)
40.9
(-1.3)
22.2
(-2.7)
80
NetAffx Links Cluster Members
Consensus/Exemplar
Group Members
GeneChip Array Information
Probe Set ID 171793_x_at
GeneChip Array C. elegans Genome Array
Organism Common Name Nematode
Probe Design Information
Transcript ID(Array Design) affy.Ce.27941
Sequence Type Exemplar sequence
Representative Public ID C35942 NCBI
Target Description C35942_rc /REP_DB=TREMBL Accession /GB=C35942 /FEA=Transcript Cluster /DEF=C.elegans cDNA clone yk450h7 : 3prime end, single read.
Cluster Evidence This cluster is supported by a Transcript Cluster.
Annotation Method Description
Annotation Description This probe set was annotated using the Genome Target Overlap based pipeline to a RefSeq identifier using 1 transcript(s).
Annotation Grade This is a grade B annotation.
Annotation Transcript Cluster (# of Matching Probes) NM_076912
Transcript Assignments
Representative
Transcript
Description Matching Probes Related Probesets by Grade
NM_076912 NCBI Caenorhabditis elegans MEChanosensory abnormality family member (mec-7) (mec-7) mRNA, complete cds. A 
SNAP00000014390 ENSEMBL cdna:SNAP chromosome:CEL140:X:7774910:7776505:-1 None
GENEFINDER00000014403 ENSEMBL cdna:GeneFinder chromosome:CEL140:X:7774910:7776505:-1 None
ZK154.3 ENSEMBL cdna:known chromosome:CEL140:X:7774798:7776621:-1 gene:ZK154.3 A 
Annotation Notes
There are no noteworthy cross hybridizing mRNAs found for this probe set.
Genomic Alignment of Consensus/Exemplar Sequence
Assembly Wormbase March 2004
Alignment(s)
Position Identity Coverage Cytoband
chrX:7774857-7775162(-) 85.0 85.0
Public Domain and Genome References
Gene Title beta tubulin
Gene Symbol mec-7
Ensembl ZK154.3
Entrez Gene 181036 Entrez gene
SwissProt P12456 EMBL-EBI
WormBase CE15257 Wormbase
Functional Annotations
Ortholog
ID Title Organism
ATH1-121501:266295_AT tubulin beta-7 chain (TUB7) at
CANINE:1585654_AT similar to tubulin, beta cfa
CANINE_2:CFA.14859.1.A1_AT similar to tubulin, beta cfa
DROSOPHILA_2:1624746_AT Tubulin at 85D dm
DROSGENOME1:143393_AT Tubulin at 85D dm
CHICKEN:GGA.1815.1.S1_AT tubulin, beta 2 gga
HG-U95AV2:39332_AT tubulin, beta polypeptide paralog hs
HG-U95AV2:429_F_AT tubulin, beta polypeptide paralog hs
HC-G110:429_F_AT tubulin, beta polypeptide paralog hs
U133_X3P:HS.179661.4.S1_3P_X_AT tubulin, beta polypeptide paralog hs
U133_X3P:HS.179661.4.S1_3P_A_AT tubulin, beta polypeptide paralog hs
U133_X3P:HS.179661.3.S1_3P_X_AT tubulin, beta polypeptide paralog hs
HG-U133A_2:209372_X_AT tubulin, beta polypeptide paralog hs
HG-U133_PLUS_2:209372_X_AT tubulin, beta polypeptide paralog hs
HG-U133A:209372_X_AT tubulin, beta polypeptide paralog hs
HG-U133A_2:214023_X_AT tubulin, beta polypeptide paralog hs
HG-U133_PLUS_2:214023_X_AT tubulin, beta polypeptide paralog hs
HG-U133A:214023_X_AT tubulin, beta polypeptide paralog hs
MOUSE430A_2:1419966_AT RIKEN cDNA 2410129E14 gene mm
MOE430A:1419966_AT RIKEN cDNA 2410129E14 gene mm
MOUSE430_2:1419966_AT RIKEN cDNA 2410129E14 gene mm
MOUSE430A_2:1449682_S_AT RIKEN cDNA 2410129E14 gene mm
MOE430A:1449682_S_AT RIKEN cDNA 2410129E14 gene mm
MOUSE430_2:1449682_S_AT RIKEN cDNA 2410129E14 gene mm
MOUSE430A_2:1449683_X_AT RIKEN cDNA 2410129E14 gene mm
MOE430A:1449683_X_AT RIKEN cDNA 2410129E14 gene mm
MOUSE430_2:1449683_X_AT RIKEN cDNA 2410129E14 gene mm
MU11KSUBB:MSA.26238.0_S_AT RIKEN cDNA 2410129E14 gene mm
MU11KSUBB:MSA.12367.0_AT RIKEN cDNA 2410129E14 gene mm
MOE430A:1427347_S_AT RIKEN cDNA 2410129E14 gene mm
MOUSE430A_2:1427347_S_AT RIKEN cDNA 2410129E14 gene mm
MOUSE430_2:1427347_S_AT RIKEN cDNA 2410129E14 gene mm
MOE430A:1452679_AT RIKEN cDNA 2410129E14 gene mm
MOUSE430A_2:1452679_AT RIKEN cDNA 2410129E14 gene mm
MOUSE430_2:1452679_AT RIKEN cDNA 2410129E14 gene mm
MU19KSUBB:TC33792_AT RIKEN cDNA 2410129E14 gene (2410129E14Rik), mRNA mm
RAE230A:1388131_AT similar to tubulin, beta (predicted) rn
RAT230_2:1388131_AT similar to tubulin, beta (predicted) rn
RG-U34A:X03369_I_AT similar to tubulin, beta (predicted) rn
RG-U34A:X03369_S_AT similar to tubulin, beta (predicted) rn
RG-U34B:RC_AA899219_I_AT similar to tubulin, beta (predicted) rn
RAE230B:1379995_AT Similar to tubulin, beta 2 rn
RAT230_2:1379995_AT Similar to tubulin, beta 2 rn
RG-U34B:RC_AI060086_AT Similar to tubulin, beta 2 rn
Gene Ontology
GO Biological Process (view graph)
ID Description Evidence Links
7018 microtubule-based movement inferred from electronic annotation QuickGO AmiGO
46785 microtubule polymerization inferred from electronic annotation QuickGO AmiGO
GO Cellular Component (view graph)
ID Description Evidence Links
5874 microtubule inferred from electronic annotation QuickGO AmiGO
45298 tubulin inferred from electronic annotation QuickGO AmiGO
43005 neuron projection inferred from direct assay QuickGO AmiGO
GO Molecular Function (view graph)
ID Description Evidence Links
3924 GTPase activity inferred from electronic annotation QuickGO AmiGO
5198 structural molecule activity inferred from electronic annotation QuickGO AmiGO
5525 GTP binding inferred from electronic annotation QuickGO AmiGO
Protein Similarities
Method ID Description E-Value
blast AAB09092 Mechanosensory abnormality protein 7 [Caenorhabditis elegans] emb|CAA33320.1| beta-tubulin [Caenorhabditis elegans] ref|NP_509313.1| MEChanosensory abnormality family member (mec-7) [Caenorhabditis elegans] sp|P12456|TBB1_CAEEL Tubulin beta-1 chain (Beta-1 tubulin) 0.0
blast Q17299 Tubulin beta-1 chain (Beta-1 tubulin) emb|CAE70274.1| Hypothetical protein CBG16786 [Caenorhabditis briggsae] gb|AAB01983.1| beta tubulin 0.0
blast P02554 Tubulin beta chain pdb|1SA1|D Chain D, Tubulin-Podophyllotoxin: Stathmin-Like Domain Complex pdb|1SA1|B Chain B, Tubulin-Podophyllotoxin: Stathmin-Like Domain Complex pdb|1SA0|D Chain D, Tubulin-Colchicine: Stathmin-Like Domain Complex pdb|1SA0|B Chain B, Tubulin-Colchicine: Stathmin-Like Domain Complex pdb|1IA0|B Chain B, Kif1a Head-Microtubule Complex Structure In Atp-Form pdb|1JFF|B Chain B, Refined Structure Of Alpha-Beta Tubulin From Zinc-Induced Sheets Stabilized With Taxol pdb|1FFX|D Chain D, Tubulin:stathmin-Like Domain Complex pdb|1FFX|B Chain B, Tubulin:stathmin-Like Domain Complex 0.0
Protein Domains
Database ID Description E-Value
Pfam IPR003008 EMBL-EBI Tubulin/FtsZ, GTPase 2.7E-112
Pfam IPR008280 EMBL-EBI Tubulin/FtsZ, C-terminal 1.6E-81
Sequence
Target Sequence
>C. ELEGANS:171793_X_AT
agagcagttcacagctatgttccgccgcaaagctttccttcattggtacactggcgaggg
aatggacgagatggaattcactgaggcggagagcaacatgagcgatcttgtttcggaata
ccaacaataccaggaggcagctgctgatgaagataccgccgaagcgttcgccggagagta
aatcatatttcctaaccaagtt


BLASTn GenBank NR
Probe Info
Probe Sequence(5'-3') Probe X Probe Y Probe Interrogation
Position
Strandedness
AGAGCAGTTCACAGCTATGTTCCGC 510 65 81 Antisense
AGCTTTCCTTCATTGGTACACTGGC 134 79 111 Antisense
GGTACACTGGCGAGGGAATGGACGA 603 497 125 Antisense
GACGAGATGGAATTCACTGAGGCGG 54 375 145 Antisense
GAGGCGGAGAGCAACATGAGCGATC 74 407 163 Antisense
GAGCGATCTTGTTTCGGAATACCAA 105 385 180 Antisense
ACAATACCAGGAGGCAGCTGCTGAT 172 113 204 Antisense
GCAGCTGCTGATGAAGATACCGCCG 610 313 217 Antisense
TGAAGATACCGCCGAAGCGTTCGCC 242 573 228 Antisense
AGCGTTCGCCGGAGAGTAAATCATA 79 81 243 Antisense
GTAAATCATATTTCCTAACCAAGTT 82 457 258 Antisense
Sequence Source Affymetrix Proprietary Database