[Home] | [Total List]

[171750_x_at] RETINAL DEGENERATION B PROTEIN (PROBABLE CALCIUM TRANSPORTER RDGB)

Description C56852_rc /REP_DB=TREMBL Accession /GB=C56852 /CHR=3 /FEA=Genomic Cluster /DEF=C.elegans cDNA clone yk278g1 : 3prime end, single read.
Cluster 6grp_highest_10_10 > 40      6grp_high1_10_10 > 05      4grp_highest_8_8 > 50      4grp_high_8_8 > 40      6grp_highest_nonorm > 30      6grp_total > 05      4grp_total > 55      6grp_highest_sub > De      6grp_high1_sub > De      

Scale

Warning: fopen(./gnuplot/171750_x_at_1_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/171750_x_at_1_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/171750_x_at_2_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/171750_x_at_2_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 764
1 2 3 4 range
A 1152.1
(3)
P
547.4
(-2)
P
708.7
(-0.7)
P
430.1
(-3)
P
722
B 908.7
(3)
P
495.2
(-3)
P
715.9
(0.2)
P
543.7
(-2.3)
P
414
C 1194.6
(3)
P
752.1
(-0.8)
P
492.3
(-3)
P
514.5
(-2.8)
P
702
avr 1085.1
(3)
598.2
(-2)
639
(-1.5)
496.1
(-3)
589

Warning: fopen(./gnuplot/171750_x_at_dSignal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/171750_x_at_dSignal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 1087
1 2 3 4 5 6 range
A 1194
(3)
P
1042.8
(1.8)
P
654.8
(-1.3)
P
442.3
(-3)
P
723.3
(-0.8)
P
486.2
(-2.6)
P
752
B 1485.5
(3)
P
986.6
(-0)
P
644.3
(-2.1)
P
682.1
(-1.8)
P
610.7
(-2.3)
P
490.7
(-3)
P
995
C 1206.5
(3)
P
977.5
(1.3)
P
766
(-0.3)
P
551.4
(-1.9)
P
623.5
(-1.3)
P
398.2
(-3)
P
808
avr 1295.3
(3)
1002.3
(0.9)
688.4
(-1.4)
558.6
(-2.3)
652.5
(-1.6)
458.4
(-3)
837
No Scale

Warning: fopen(./gnuplot/171750_x_at_1_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/171750_x_at_1_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/171750_x_at_2_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/171750_x_at_2_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 357
1 2 3 4 range
A 419.5
(3)
P
118.8
(-2.1)
P
185.3
(-0.9)
P
63
(-3)
P
357
B 289.8
(3)
P
122.3
(-2.8)
P
165.9
(-1.3)
P
115.9
(-3)
P
174
C 395.4
(3)
P
216.2
(-0.5)
P
171.6
(-1.4)
P
86.8
(-3)
P
309
avr 368.2
(3)
152.4
(-1.6)
174.3
(-1.2)
88.6
(-3)
280

Warning: fopen(./gnuplot/171750_x_at_dNo_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/171750_x_at_dNo_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 406
1 2 3 4 5 6 range
A 220.1
(-0.5)
P
370.9
(3)
P
142.6
(-2.3)
P
112.2
(-3)
P
218.3
(-0.5)
P
118.4
(-2.9)
P
259
B 516.9
(3)
P
328.4
(-0.1)
P
156.5
(-3)
P
180.7
(-2.6)
P
248.1
(-1.5)
P
183
(-2.6)
P
360
C 447.2
(3)
P
298.3
(0.3)
P
195
(-1.5)
P
110.9
(-3)
P
201.8
(-1.4)
P
133.3
(-2.6)
P
336
avr 394.7
(3)
332.5
(1.6)
164.7
(-2.3)
134.6
(-3)
222.7
(-1)
144.9
(-2.8)
260
NetAffx Links Cluster Members
Consensus/Exemplar
Group Members
GeneChip Array Information
Probe Set ID 171750_x_at
GeneChip Array C. elegans Genome Array
Organism Common Name Nematode
Probe Design Information
Transcript ID(Array Design) affy.Ce.20983
Sequence Type Exemplar sequence
Representative Public ID C56852 NCBI
Target Description C56852_rc /REP_DB=TREMBL Accession /GB=C56852 /CHR=3 /FEA=Genomic Cluster /DEF=C.elegans cDNA clone yk278g1 : 3prime end, single read.
Cluster Evidence This cluster is supported by a Genomic Cluster.
Annotation Method Description
Annotation Description This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s).
Annotation Grade This is a grade A annotation.
Annotation Transcript Cluster (# of Matching Probes) NM_065325(11)
Transcript Assignments
Representative
Transcript
Description Matching Probes Related Probesets by Grade
NM_065325 NCBI Caenorhabditis elegans M01F1.7 (M01F1.7) mRNA, complete cds. 11/11 None
M01F1.7 ENSEMBL cdna:known chromosome:CEL140:III:3521129:3529710:-1 gene:M01F1.7 11/11 A 
Annotation Notes
Cross Hybridizing mRNA Matched Probes Nature of Assignment Related Probesets by Grade
NM_171326 1/11 Cross Hyb Matching Probes None
R11E3.5a 1/11 Cross Hyb Matching Probes A 
Genomic Alignment of Consensus/Exemplar Sequence
Assembly Wormbase March 2004
Alignment(s)
Position Identity Coverage Cytoband
chrIII:3521196-3521476(-) 100.0 100.0
Public Domain and Genome References
Gene Title RETINAL DEGENERATION B PROTEIN (PROBABLE CALCIUM TRANSPORTER RDGB)
Ensembl M01F1.7
Entrez Gene 175459 Entrez gene
SwissProt O62119 EMBL-EBI
WormBase CE33673 Wormbase
Functional Annotations
Ortholog
ID Title Organism
CANINE:1600800_AT similar to phosphatidylinositol transfer protein, membrane-associated 2 cfa
CANINE_2:CFA.7012.1.A1_AT similar to phosphatidylinositol transfer protein, membrane-associated 2 cfa
CANINE_2:CFAAFFX.12317.1.S1_S_AT similar to phosphatidylinositol transfer protein, membrane-associated 2 cfa
DROSOPHILA_2:1639574_A_AT retinal degeneration B dm
DROSOPHILA_2:1634099_AT retinal degeneration B dm
DROSGENOME1:152278_AT retinal degeneration B dm
HG-U133_PLUS_2:232950_S_AT phosphatidylinositol transfer protein, membrane-associated 2 hs
HG-U133B:232950_S_AT phosphatidylinositol transfer protein, membrane-associated 2 hs
U133_X3P:HS2.272759.1.S2_3P_S_AT phosphatidylinositol transfer protein, membrane-associated 2 hs
U133_X3P:HS2.272759.1.S1_3P_S_AT phosphatidylinositol transfer protein, membrane-associated 2 hs
U133_X3P:HS.272759.1.S1_3P_A_AT phosphatidylinositol transfer protein, membrane-associated 2 hs
HG-U133_PLUS_2:1552923_A_AT phosphatidylinositol transfer protein, membrane-associated 2 hs
HG-U133_PLUS_2:1552924_A_AT phosphatidylinositol transfer protein, membrane-associated 2 hs
HG-U95E:82997_AT phosphatidylinositol transfer protein, membrane-associated 2 hs
HG-U95E:84229_AT phosphatidylinositol transfer protein, membrane-associated 2 hs
U133_X3P:HS2.378849.1.S1_3P_AT Phosphatidylinositol transfer protein, membrane-associated 2 hs
HG-U133_PLUS_2:1562550_AT Phosphatidylinositol transfer protein, membrane-associated 2 hs
MOE430A:1430197_A_AT phosphatidylinositol transfer protein, membrane-associated 2 mm
MOUSE430A_2:1430197_A_AT phosphatidylinositol transfer protein, membrane-associated 2 mm
MOUSE430_2:1430197_A_AT phosphatidylinositol transfer protein, membrane-associated 2 mm
MOE430A:1419757_AT phosphatidylinositol transfer protein, membrane-associated 2 mm
MOUSE430A_2:1419757_AT phosphatidylinositol transfer protein, membrane-associated 2 mm
MOUSE430_2:1419757_AT phosphatidylinositol transfer protein, membrane-associated 2 mm
MG-U74CV2:139194_AT phosphatidylinositol transfer protein, membrane-associated 2 mm
MG-U74CV2:140704_AT phosphatidylinositol transfer protein, membrane-associated 2 mm
MG-U74CV2:138154_AT Phosphatidylinositol transfer protein, membrane-associated 2 (Pitpnm2), mRNA mm
Gene Ontology
GO Biological Process (view graph)
ID Description Evidence Links
6810 transport inferred from electronic annotation QuickGO AmiGO
GO Cellular Component (view graph)
ID Description Evidence Links
5622 intracellular inferred from electronic annotation QuickGO AmiGO
GO Molecular Function (view graph)
ID Description Evidence Links
46872 metal ion binding inferred from electronic annotation QuickGO AmiGO
Protein Similarities
Method ID Description E-Value
blast CAB00857 Hypothetical protein M01F1.7 [Caenorhabditis elegans] emb|CAA86520.2| Hypothetical protein M01F1.7 [Caenorhabditis elegans] ref|NP_497726.2| M01F1.7 [Caenorhabditis elegans] 0.0
blast CAE64927 Hypothetical protein CBG09751 [Caenorhabditis briggsae] 0.0
blast XP_849294 PREDICTED: similar to phosphatidylinositol transfer protein, membrane-associated 2 isoform 2 [Canis familiaris] 1.0E-109
Protein Domains
Database ID Description E-Value
Pfam IPR004177 EMBL-EBI DDHD domain 5.6E-34
Pfam IPR004177 EMBL-EBI DDHD domain 4.4E-24
Pfam IPR001666 EMBL-EBI Phosphatidylinositol transfer protein 1.0E-126
Sequence
Target Sequence
>C. ELEGANS:171750_X_AT
agtaggcacaactattccatgaaaatagtatatttttccaattttttccacaacaaaata
cggataaaactctcccacaactccttccactcacacaacattccgaaataaaatcataaa
atcaataaataatcgaaaattggctataattctcatctcaggttgtcacttttttctctc
ccgaattaaacgttccaatagatttttcaatctcccagtgttctcaaattctagtttttt
tct


BLASTn GenBank NR
Probe Info
Probe Sequence(5'-3') Probe X Probe Y Probe Interrogation
Position
Strandedness
AGTAGGCACAACTATTCCATGAAAA 275 61 17 Antisense
TACGGATAAAACTCTCCCACAACTC 17 649 75 Antisense
TCCACTCACACAACATTCCGAAATA 382 589 102 Antisense
ATTGGCTATAATTCTCATCTCAGGT 162 3 155 Antisense
AATTCTCATCTCAGGTTGTCACTTT 215 177 164 Antisense
ATCTCAGGTTGTCACTTTTTTCTCT 679 31 171 Antisense
TCTCTCCCGAATTAAACGTTCCAAT 564 589 191 Antisense
TAAACGTTCCAATAGATTTTTCAAT 493 635 203 Antisense
TAGATTTTTCAATCTCCCAGTGTTC 357 653 215 Antisense
ATCTCCCAGTGTTCTCAAATTCTAG 345 33 226 Antisense
TGTTCTCAAATTCTAGTTTTTTTCT 588 561 235 Antisense
Sequence Source Affymetrix Proprietary Database