[Home] | [Total List]

[171745_x_at]

Description CEK008CXR_rc /REP_DB=TREMBL Accession /GB=D28033 /CHR=1 /FEA=Genomic Cluster /DEF=C.elegans cDNA clone yk8c10 : 3prime end, single read.
Cluster 6grp_highest_10_10 > 09      6grp_high1_10_10 > 91      4grp_highest_8_8 > 11      4grp_high_8_8 > 47      6grp_highest_nonorm > 72      6grp_total > 93      4grp_total > 48      6grp_cgc > 98      6grp_high1_sub > 05      6grp_total_sub > Hat      4grp_rule_based > L3      

Scale

Warning: fopen(./gnuplot/171745_x_at_1_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/171745_x_at_1_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/171745_x_at_2_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/171745_x_at_2_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 833
1 2 3 4 range
A 206.7
(-3)
P
664.2
(0.5)
P
1000.9
(3)
P
254.2
(-2.6)
P
794
B 189.7
(-3)
P
746.6
(1.5)
P
938.3
(3)
P
406.6
(-1.3)
P
749
C 168.3
(-3)
P
640.8
(1.9)
P
741.3
(3)
P
328.9
(-1.3)
P
573
avr 188.2
(-3)
683.9
(1.2)
893.5
(3)
329.9
(-1.8)
705

Warning: fopen(./gnuplot/171745_x_at_dSignal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/171745_x_at_dSignal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 469
1 2 3 4 5 6 range
A 229.5
(-3)
P
386.7
(-0.6)
P
371.2
(-0.9)
P
515.3
(1.3)
P
628.4
(3)
P
448.6
(0.3)
P
399
B 222.5
(-3)
P
400.5
(0.1)
P
343.2
(-0.9)
P
451.4
(1)
P
563.1
(3)
P
438.7
(0.8)
P
341
C 236.8
(-2.9)
P
537.9
(1)
P
507.3
(0.6)
P
225.7
(-3)
P
691
(3)
P
331.2
(-1.6)
P
465
avr 229.6
(-3)
441.7
(0.2)
407.2
(-0.3)
397.5
(-0.5)
627.5
(3)
406.2
(-0.3)
398
No Scale

Warning: fopen(./gnuplot/171745_x_at_1_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/171745_x_at_1_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/171745_x_at_2_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/171745_x_at_2_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 225
1 2 3 4 range
A 75.3
(-2)
P
144.2
(-0.1)
P
261.7
(3)
P
37.2
(-3)
P
225
B 60.5
(-3)
P
184.4
(1.7)
P
217.4
(3)
P
86.6
(-2)
P
157
C 55.7
(-3)
P
184.2
(0.8)
P
258.4
(3)
P
55.5
(-3)
P
203
avr 63.8
(-2.9)
170.9
(0.6)
245.8
(3)
59.8
(-3)
186

Warning: fopen(./gnuplot/171745_x_at_dNo_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/171745_x_at_dNo_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 187
1 2 3 4 5 6 range
A 42.3
(-3)
P
137.5
(0.9)
P
80.8
(-1.4)
P
130.7
(0.6)
P
189.6
(3)
P
109.2
(-0.3)
P
147
B 77.4
(-3)
P
133.3
(-0.8)
P
83.3
(-2.8)
P
119.6
(-1.3)
P
228.8
(3)
P
163.6
(0.4)
P
151
C 87.8
(-1.6)
P
164.1
(1)
P
129.1
(-0.2)
P
45.4
(-3)
P
223.6
(3)
P
110.9
(-0.8)
P
178
avr 69.2
(-3)
145
(0.1)
97.7
(-1.8)
98.6
(-1.8)
214
(3)
127.9
(-0.6)
145
NetAffx Links Cluster Members
Consensus/Exemplar
Group Members
GeneChip Array Information
Probe Set ID 171745_x_at
GeneChip Array C. elegans Genome Array
Organism Common Name Nematode
Probe Design Information
Transcript ID(Array Design) affy.Ce.20455
Sequence Type Exemplar sequence
Representative Public ID CEK008CXR NCBI
Target Description CEK008CXR_rc /REP_DB=TREMBL Accession /GB=D28033 /CHR=1 /FEA=Genomic Cluster /DEF=C.elegans cDNA clone yk8c10 : 3prime end, single read.
Cluster Evidence This cluster is supported by a Genomic Cluster.
Annotation Method Description
Annotation Description This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s).
Annotation Grade This is a grade A annotation.
Annotation Transcript Cluster (# of Matching Probes) NM_058286(10)
Transcript Assignments
Representative
Transcript
Description Matching Probes Related Probesets by Grade
NM_058286 NCBI Caenorhabditis elegans PaTched Related family member (ptr-11) (ptr-11) mRNA, complete cds. 10/11 A 
F56C11.2 ENSEMBL cdna:known chromosome:CEL140:I:160172:166819:-1 gene:F56C11.2 10/11 A 
Annotation Notes
Cross Hybridizing mRNA Matched Probes Nature of Assignment Related Probesets by Grade
SNAP00000010368 5/11 Cross Hyb Matching Probes None
GENEFINDER00000010377 5/11 Cross Hyb Matching Probes None
Genomic Alignment of Consensus/Exemplar Sequence
Assembly Wormbase March 2004
Alignment(s)
Position Identity Coverage Cytoband
chrI:160210-160751(-) 100.0 100.0
Public Domain and Genome References
Gene Title
Gene Symbol ptr-11
Ensembl F56C11.2
Entrez Gene 171609 Entrez gene
SwissProt O44978 EMBL-EBI
WormBase CE17902 Wormbase
Functional Annotations
Gene Ontology
GO Cellular Component (view graph)
ID Description Evidence Links
16020 membrane inferred from electronic annotation QuickGO AmiGO
GO Molecular Function (view graph)
ID Description Evidence Links
8158 hedgehog receptor activity inferred from electronic annotation QuickGO AmiGO
Protein Similarities
Method ID Description E-Value
blast AAB97556 Patched related family protein 11 [Caenorhabditis elegans] ref|NP_490687.1| PaTched Related family member (ptr-11) [Caenorhabditis elegans] 0.0
blast CAE61284 Hypothetical protein CBG05104 [Caenorhabditis briggsae] 0.0
blast CAA87375 Hypothetical protein K07C10.1 [Caenorhabditis elegans] ref|NP_496392.1| PaTched Related family member (ptr-13) [Caenorhabditis elegans] 1.0E-110
Protein Domains
Database ID Description E-Value
Pfam IPR003392 EMBL-EBI Patched family 1.0E-126
Trans Membrane
ID Number Of Domains Domain Boundaries
NP_490687.1 11 15-37,236-258,268-290,339-361,376-398,433-455,640-659,666-688,698-717,741-763,767-789
F56C11.2 11 15-37,236-258,268-290,339-361,376-398,433-455,640-659,666-688,698-717,741-763,767-789
Sequence
Target Sequence
>C. ELEGANS:171745_X_AT
gtgtgctttgctaagaccgtttttttggtcgttgctattggtcctccacggtctcttcat
tctgcccgtcattctggcgctcttctcgaaagactcaatcaacgagaaggacaatattcc
ggcggcaatcacattctcagcggctgaaccactcgtcgacaaagatcttaacgccgtcta
aacctttgcaatcgcgcccccccgctctttttctaaaaaatttgaatttcctttatgaga
cgtgtagaagaaaacttatatactttttgttttgcctagtcgtttttcctgtttttcccc
acctgtacaaataatgttaacgcgttctgttgataca


BLASTn GenBank NR
Probe Info
Probe Sequence(5'-3') Probe X Probe Y Probe Interrogation
Position
Strandedness
GTGTGCTTTGCTAAGACCGTTTTTT 365 485 13 Antisense
TTTTGGTCGTTGCTATTGGTCCTCC 79 671 35 Antisense
GGCGCTCTTCTCGAAAGACTCAATC 237 543 88 Antisense
AATATTCCGGCGGCAATCACATTCT 111 175 125 Antisense
ATTCTCAGCGGCTGAACCACTCGTC 291 7 145 Antisense
ACCACTCGTCGACAAAGATCTTAAC 44 85 160 Antisense
TTAACGCCGTCTAAACCTTTGCAAT 75 683 180 Antisense
CGCCGTCTAAACCTTTGCAATCGCG 492 257 184 Antisense
TATACTTTTTGTTTTGCCTAGTCGT 455 659 271 Antisense
TTTTTCCCCACCTGTACAAATAATG 39 675 304 Antisense
AATGTTAACGCGTTCTGTTGATACA 216 163 325 Antisense
Sequence Source Affymetrix Proprietary Database