[Home] | [Total List]

[171736_x_at] nuclear hormone receptor

Description g1203791 /REP_DB=GenBank Identifier /5_PRIME_EXT_ID=F44A6.2A /5_PRIME_EXT_DB=WormBase Gene ID /WB_GENE_ID=F44A6.2A /WP=CE03323 /CHR=X /FEA=Genomic Cluster /GEN=cnr14; sex-1 /DEF=steroid hormone receptor family member CNR14; nuclear hormone receptor
Cluster 6grp_highest_10_10 > 86      6grp_high1_10_10 > 67      4grp_highest_8_8 > 32      4grp_high_8_8 > 43      6grp_highest_nonorm > 92      6grp_total > 68      4grp_total > 52      6grp_highest_sub > Da      6grp_cgc > 38      6grp_high1_sub > Da      6grp_cgc_sub > Da      6grp_total_sub > Increase      6grp_rule_based > S6      4grp_rule_based > L2      

Scale

Warning: fopen(./gnuplot/171736_x_at_1_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/171736_x_at_1_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/171736_x_at_2_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/171736_x_at_2_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 225
1 2 3 4 range
A 261.6
(1.9)
P
243.9
(0.5)
P
275.3
(3)
P
199
(-3)
P
76
B 274.6
(3)
P
264.3
(2.6)
P
209.1
(0.6)
P
107.6
(-3)
P
167
C 258.6
(0.8)
P
332.6
(3)
P
206.9
(-0.7)
P
127.3
(-3)
P
205
avr 264.9
(2.3)
280.3
(3)
230.4
(0.8)
144.6
(-3)
136

Warning: fopen(./gnuplot/171736_x_at_dSignal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/171736_x_at_dSignal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 387
1 2 3 4 5 6 range
A 244.1
(-1.9)
P
194.5
(-2.7)
P
175.7
(-3)
P
200.6
(-2.6)
P
270.8
(-1.5)
P
562.4
(3)
P
387
B 246.8
(-2.2)
P
230.5
(-2.5)
P
209.6
(-3)
P
261.5
(-1.8)
P
236.3
(-2.4)
P
473.4
(3)
P
264
C 226.5
(-2.3)
P
248.8
(-1.9)
P
203.7
(-2.7)
P
187.1
(-3)
P
212.3
(-2.5)
P
518.3
(3)
P
331
avr 239.1
(-2.2)
224.6
(-2.5)
196.3
(-3)
216.4
(-2.6)
239.8
(-2.2)
518
(3)
322
No Scale

Warning: fopen(./gnuplot/171736_x_at_1_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/171736_x_at_1_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/171736_x_at_2_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/171736_x_at_2_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 74
1 2 3 4 range
A 95.3
(3)
P
52.9
(-0.8)
P
72
(0.9)
P
29.1
(-3)
P
66
B 87.6
(3)
P
65.3
(0.9)
P
48.5
(-0.6)
P
22.9
(-3)
P
65
C 85.6
(2.2)
P
95.6
(3)
P
72.1
(1.1)
P
21.5
(-3)
P
74
avr 89.5
(3)
71.3
(1.3)
64.2
(0.7)
24.5
(-3)
65

Warning: fopen(./gnuplot/171736_x_at_dNo_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/171736_x_at_dNo_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 139
1 2 3 4 5 6 range
A 45
(-2.6)
P
69.2
(-1.1)
P
38.3
(-3)
P
50.9
(-2.2)
P
81.7
(-0.4)
P
136.9
(3)
P
99
B 85.9
(-1.3)
P
76.7
(-1.8)
P
50.9
(-3)
P
69.3
(-2.1)
P
96
(-0.8)
P
176.5
(3)
P
126
C 83.9
(-1)
P
75.9
(-1.3)
P
51.9
(-2.4)
P
37.6
(-3)
P
68.7
(-1.6)
P
173.5
(3)
P
136
avr 71.6
(-1.7)
73.9
(-1.6)
47
(-3)
52.6
(-2.7)
82.1
(-1.2)
162.3
(3)
115
NetAffx Links Cluster Members
Consensus/Exemplar
Group Members
GeneChip Array Information
Probe Set ID 171736_x_at
GeneChip Array C. elegans Genome Array
Organism Common Name Nematode
Probe Design Information
Transcript ID(Array Design) affy.Ce.25915
Sequence Type Exemplar sequence
Representative Public ID 1203791 NCBI
Target Description g1203791 /REP_DB=GenBank Identifier /5_PRIME_EXT_ID=F44A6.2A /5_PRIME_EXT_DB=WormBase Gene ID /WB_GENE_ID=F44A6.2A /WP=CE03323 /CHR=X /FEA=Genomic Cluster /GEN=cnr14; sex-1 /DEF=steroid hormone receptor family member CNR14; nuclear hormone receptor
Cluster Evidence This cluster is supported by a Genomic Cluster.
Annotation Method Description
Annotation Description This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s).
Annotation Grade This is a grade A annotation.
Annotation Transcript Cluster (# of Matching Probes) NM_001029491(11)
Transcript Assignments
Representative
Transcript
Description Matching Probes Related Probesets by Grade
NM_001029491 NCBI Caenorhabditis elegans Signal Element on X family member (sex-1) (sex-1) mRNA, complete cds. 11/11 None
F44A6.2a ENSEMBL cdna:known chromosome:CEL140:X:10201256:10205349:-1 gene:F44A6.2 11/11 A 
Annotation Notes
Cross Hybridizing mRNA Matched Probes Nature of Assignment Related Probesets by Grade
SNAP00000009272 6/11 Cross Hyb Matching Probes None
GENEFINDER00000009276 6/11 Cross Hyb Matching Probes None
F44A6.2b 6/11 Cross Hyb Matching Probes A 
Genomic Alignment of Consensus/Exemplar Sequence
Assembly Wormbase March 2004
Alignment(s)
Position Identity Coverage Cytoband
chrX:10201332-10205350(-) 100.0 100.0
Public Domain and Genome References
Gene Title nuclear hormone receptor
Gene Symbol sex-1
Ensembl F44A6.2
Entrez Gene 181231 Entrez gene
SwissProt P41830 EMBL-EBI
WormBase CE03323 Wormbase
Functional Annotations
Ortholog
ID Title Organism
DROSOPHILA_2:1640770_A_AT Ecdysone-induced protein 78C dm
DROSGENOME1:143525_AT Ecdysone-induced protein 78C dm
Gene Ontology
GO Biological Process (view graph)
ID Description Evidence Links
6355 regulation of transcription, DNA-dependent inferred from electronic annotation QuickGO AmiGO
16481 negative regulation of transcription inferred from direct assay QuickGO AmiGO
GO Cellular Component (view graph)
ID Description Evidence Links
5634 nucleus inferred from electronic annotation QuickGO AmiGO
5634 nucleus inferred from direct assay QuickGO AmiGO
GO Molecular Function (view graph)
ID Description Evidence Links
3677 DNA binding inferred from electronic annotation QuickGO AmiGO
3700 transcription factor activity inferred from electronic annotation QuickGO AmiGO
3707 steroid hormone receptor activity inferred from electronic annotation QuickGO AmiGO
4879 ligand-dependent nuclear receptor activity inferred from electronic annotation QuickGO AmiGO
4879 ligand-dependent nuclear receptor activity inferred from sequence similarity QuickGO AmiGO
Protein Similarities
Method ID Description E-Value
blast CAA90722 Hypothetical protein F44A6.2 [Caenorhabditis elegans] ref|NP_001024662.1| Signal Element on X family member (sex-1) [Caenorhabditis elegans] sp|P41830|CNR14_CAEEL Steroid hormone receptor family member cnr14 gb|AAA96982.1| steroid hormone receptor family member CNR14 0.0
blast AAC77795 SEX-1; NHR [Caenorhabditis elegans] 0.0
blast AAG15187 sex-1 [Caenorhabditis elegans] 0.0
Protein Domains
Database ID Description E-Value
Pfam IPR000536 EMBL-EBI Ligand-binding domain of nuclear hormone receptor 9.2E-19
Pfam IPR001628 EMBL-EBI Zn-finger, C4-type steroid receptor 3.2E-52
Sequence
Target Sequence
>C. ELEGANS:171736_X_AT
tattcattgtccttattctttgccagccactaaccacggaacaacaattttctactaact
tcaaaagtcaattgcagttgctggaaatgtttgatttttacaagaaagttcttttccaaa
aaatgacatgccgcattgacggatgcgatacatacaaacaacttatgaaatgtattcatg
aattgaatcgacttgatgagctacataaacagcaactcaatattcttcgagaaaatttgt
cgtttttaaacctgcctcctctcgttgtggaaatgttccaactctcaacacttccgttgc
ctgttaaccataacaaccaagagaaccaatatactcctgctccagagcatcagagccctc
aaccacagcagccaacgccaaatcaacaacagactcccgttcactgctagccacctttgt
cagattctcatccgttttcattccaacacaattcaccttcaaataatttcgctttaatgt
agttaagtattcaatctctccttcctgcccgtttccaacccaaaagtcacgtgtctgatg
actgctgtttaataattcttgcaaggattgccacaatccagcattttgct


BLASTn GenBank NR
Probe Info
Probe Sequence(5'-3') Probe X Probe Y Probe Interrogation
Position
Strandedness
TATTCATTGTCCTTATTCTTTGCCA 681 663 1209 Antisense
GCCTCCTCTCGTTGTGGAAATGTTC 50 281 1462 Antisense
AAATGTTCCAACTCTCAACACTTCC 521 119 1479 Antisense
AGAGAACCAATATACTCCTGCTCCA 454 69 1528 Antisense
GCTCCAGAGCATCAGAGCCCTCAAC 88 299 1547 Antisense
CAGCCAACGCCAAATCAACAACAGA 429 203 1577 Antisense
TTGTCAGATTCTCATCCGTTTTCAT 699 707 1625 Antisense
TCATTCCAACACAATTCACCTTCAA 317 619 1646 Antisense
GTTAAGTATTCAATCTCTCCTTCCT 609 445 1690 Antisense
TCCAACCCAAAAGTCACGTGTCTGA 411 585 1722 Antisense
GATTGCCACAATCCAGCATTTTGCT 607 433 1774 Antisense
Sequence Source GenBank