[Home] | [Total List]

[171734_x_at] Cytochrome C oxidase

Description CEK100E6F /REP_DB=TREMBL Accession /GB=D70214 /CHR=3 /FEA=Genomic Cluster /DEF=C.elegans cDNA clone yk100e6 : 5prime end, single read.
Cluster 6grp_highest_10_10 > 26      6grp_high1_10_10 > 62      4grp_highest_8_8 > 14      4grp_high_8_8 > 14      6grp_highest_nonorm > 18      6grp_total > 61      4grp_total > 09      6grp_highest_sub > 03      6grp_cgc > 93      6grp_high1_sub > 03      6grp_cgc_sub > 03      6grp_total_sub > Hat      4grp_rule_based > L4      

Scale

Warning: fopen(./gnuplot/171734_x_at_1_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/171734_x_at_1_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/171734_x_at_2_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/171734_x_at_2_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 14552
1 2 3 4 range
A 15954.7
(-3)
P
18308
(-2)
P
19316.2
(-1.6)
P
30435.8
(3)
P
14481
B 17644.9
(-3)
P
18236.2
(-2.4)
P
20454.9
(-0.2)
P
23767.9
(3)
P
6123
C 15883.9
(-3)
P
17683.9
(-2.1)
P
16257.9
(-2.8)
P
27999.2
(3)
P
12115
avr 16494.5
(-3)
18076
(-2.1)
18676.3
(-1.8)
27401
(3)
10907

Warning: fopen(./gnuplot/171734_x_at_dSignal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/171734_x_at_dSignal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 8416
1 2 3 4 5 6 range
A 19551.4
(-0.2)
P
16893.9
(-2.6)
P
22987.5
(3)
P
19958.5
(0.2)
P
16576.9
(-2.9)
P
16479.1
(-3)
P
6508
B 15695.4
(-1.9)
P
15604.6
(-2)
P
20958.1
(3)
P
18551.6
(0.7)
P
14571.6
(-3)
P
14590.1
(-3)
P
6386
C 14775.9
(-3)
P
15563
(-2.3)
P
19501.7
(1.3)
P
21362.6
(3)
P
17993.7
(-0.1)
P
15255.4
(-2.6)
P
6587
avr 16674.2
(-1.7)
16020.5
(-2.4)
21149.1
(3)
19957.6
(1.7)
16380.7
(-2)
15441.5
(-3)
5708
No Scale

Warning: fopen(./gnuplot/171734_x_at_1_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/171734_x_at_1_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/171734_x_at_2_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/171734_x_at_2_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 1835
1 2 3 4 range
A 5809.1
(3)
P
3974.2
(-3)
P
5049.6
(0.5)
P
4455.2
(-1.4)
P
1835
B 5626.8
(3)
P
4503.9
(-3)
P
4739.9
(-1.7)
P
5064.9
(-0)
P
1123
C 5258
(0.4)
P
5084.2
(-0.7)
P
5666.4
(3)
P
4721.1
(-3)
P
945
avr 5564.6
(3)
4520.8
(-3)
5152
(0.6)
4747.1
(-1.7)
1044

Warning: fopen(./gnuplot/171734_x_at_dNo_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/171734_x_at_dNo_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 2404
1 2 3 4 5 6 range
A 3604.1
(-3)
P
6008.3
(3)
P
5006.2
(0.5)
P
5062
(0.6)
P
5002.2
(0.5)
P
4012.2
(-2)
P
2404
B 5461.2
(0.3)
P
5194.1
(-1.3)
P
5089.3
(-2)
P
4913.7
(-3)
P
5920.3
(3)
P
5440.6
(0.1)
P
1007
C 5476.8
(1.6)
P
4748.8
(-1.2)
P
4963.5
(-0.4)
P
4296
(-3)
P
5822.5
(3)
P
5106.9
(0.2)
P
1527
avr 4847.4
(-2.3)
5317.1
(1.1)
5019.7
(-1.1)
4757.2
(-3)
5581.7
(3)
4853.2
(-2.3)
825
NetAffx Links Cluster Members
Consensus/Exemplar
Group Members
GeneChip Array Information
Probe Set ID 171734_x_at
GeneChip Array C. elegans Genome Array
Organism Common Name Nematode
Probe Design Information
Transcript ID(Array Design) affy.Ce.20893
Sequence Type Exemplar sequence
Representative Public ID CEK100E6F NCBI
Target Description CEK100E6F /REP_DB=TREMBL Accession /GB=D70214 /CHR=3 /FEA=Genomic Cluster /DEF=C.elegans cDNA clone yk100e6 : 5prime end, single read.
Cluster Evidence This cluster is supported by a Genomic Cluster.
Annotation Method Description
Annotation Description This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s).
Annotation Grade This is a grade A annotation.
Annotation Transcript Cluster (# of Matching Probes) NM_065681(11)
Transcript Assignments
Representative
Transcript
Description Matching Probes Related Probesets by Grade
NM_065681 NCBI Caenorhabditis elegans F54D8.2 (F54D8.2) mRNA, complete cds. 11/11 A 
SNAP00000022621 ENSEMBL cdna:SNAP chromosome:CEL140:III:5081694:5082816:1 11/11 None
GENEFINDER00000022632 ENSEMBL cdna:GeneFinder chromosome:CEL140:III:5081694:5082816:1 11/11 None
F54D8.2.2 ENSEMBL cdna:known chromosome:CEL140:III:5081683:5082955:1 gene:F54D8.2 11/11 A 
F54D8.2.4 ENSEMBL cdna:known chromosome:CEL140:III:5081683:5082955:1 gene:F54D8.2 11/11 None
F54D8.2.3 ENSEMBL cdna:known chromosome:CEL140:III:5081685:5082969:1 gene:F54D8.2 11/11 A 
F54D8.2.1 ENSEMBL cdna:known chromosome:CEL140:III:5081685:5083350:1 gene:F54D8.2 11/11 A 
Annotation Notes
There are no noteworthy cross hybridizing mRNAs found for this probe set.
Genomic Alignment of Consensus/Exemplar Sequence
Assembly Wormbase March 2004
Alignment(s)
Position Identity Coverage Cytoband
chrIII:5081812-5082877(+) 100.0 100.0
Public Domain and Genome References
Gene Title Cytochrome C oxidase
Ensembl F54D8.2
Entrez Gene 175693 Entrez gene
SwissProt Q20779 EMBL-EBI
WormBase CE01308 Wormbase
Functional Annotations
Gene Ontology
GO Biological Process (view graph)
ID Description Evidence Links
6118 electron transport inferred from electronic annotation QuickGO AmiGO
GO Cellular Component (view graph)
ID Description Evidence Links
5740 mitochondrial membrane inferred from electronic annotation QuickGO AmiGO
GO Molecular Function (view graph)
ID Description Evidence Links
4129 cytochrome-c oxidase activity inferred from electronic annotation QuickGO AmiGO
Protein Similarities
Method ID Description E-Value
blast AAA20614 Hypothetical protein F54D8.2 [Caenorhabditis elegans] ref|NP_498082.1| F54D8.2 [Caenorhabditis elegans] sp|Q20779|COX6A_CAEEL Probable cytochrome c oxidase polypeptide VIa, mitochondrial precursor 5.0E-72
blast CAE75086 Hypothetical protein CBG23006 [Caenorhabditis briggsae] 3.0E-63
Protein Domains
Database ID Description E-Value
Pfam IPR001349 EMBL-EBI Cytochrome c oxidase, subunit VIa 9.4E-68
Trans Membrane
ID Number Of Domains Domain Boundaries
NP_498082.1 1 54-71
F54D8.2.2 1 54-71
F54D8.2.4 1 54-71
F54D8.2.3 1 54-71
F54D8.2.1 1 54-71
SNAP00000022621 1 54-71
GENEFINDER00000022632 1 54-71
Sequence
Target Sequence
>C. ELEGANS:171734_X_AT
gcaagctcacacgagacctggaagaaaatcttcttcattgcttcgattccatgcttggct
cttaccatgtatgccgccttcaaggatcacaaaaaacacatgagccacgaacgcccagag
cacgtcgagtacgccttcttgaacgttcgcaacaagccattcccatggtccgatggaaat
cactcattgttccacaacaaggcggagcaatttgttccaggagttggattcgaggctgac
cgtg


BLASTn GenBank NR
Probe Info
Probe Sequence(5'-3') Probe X Probe Y Probe Interrogation
Position
Strandedness
GCAAGCTCACACGAGACCTGGAAGA 401 321 18 Antisense
AATCTTCTTCATTGCTTCGATTCCA 603 169 44 Antisense
TTCCATGCTTGGCTCTTACCATGTA 620 697 64 Antisense
TTACCATGTATGCCGCCTTCAAGGA 297 679 79 Antisense
AAAAACACATGAGCCACGAACGCCC 621 129 109 Antisense
CGAGTACGCCTTCTTGAACGTTCGC 291 155 143 Antisense
TTGAACGTTCGCAACAAGCCATTCC 443 705 156 Antisense
AGCCATTCCCATGGTCCGATGGAAA 482 83 172 Antisense
GAAATCACTCATTGTTCCACAACAA 307 363 193 Antisense
GGCGGAGCAATTTGTTCCAGGAGTT 289 539 218 Antisense
GGAGTTGGATTCGAGGCTGACCGTG 411 517 237 Antisense
Sequence Source Affymetrix Proprietary Database