[Home] | [Total List]

[171731_x_at] Zinc finger, C2H2 type

Description CEK044A9R_rc /REP_DB=TREMBL Accession /GB=D34307 /CHR=2 /FEA=Genomic Cluster /DEF=C.elegans cDNA clone yk44a9 : 3prime end, single read.
Cluster 6grp_highest_10_10 > 83      6grp_high1_10_10 > 47      4grp_highest_8_8 > 59      4grp_high_8_8 > 25      6grp_highest_nonorm > 77      6grp_total > 37      4grp_total > 38      6grp_highest_sub > Cu      6grp_high1_sub > Cu      6grp_total_sub > Cup      

Scale

Warning: fopen(./gnuplot/171731_x_at_1_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/171731_x_at_1_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/171731_x_at_2_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/171731_x_at_2_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 1035
1 2 3 4 range
A 1876.4
(3)
P
1350.8
(-0.8)
P
1047
(-3)
P
1169.9
(-2.1)
P
829
B 2080.6
(3)
P
1368.2
(-2)
P
1233
(-3)
P
1617.4
(-0.3)
P
848
C 2081.6
(3)
P
1258.6
(-2.7)
P
1219.3
(-3)
P
1390.6
(-1.8)
P
862
avr 2012.9
(3)
1325.9
(-1.9)
1166.4
(-3)
1392.6
(-1.4)
847

Warning: fopen(./gnuplot/171731_x_at_dSignal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/171731_x_at_dSignal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 1065
1 2 3 4 5 6 range
A 1900
(3)
P
1744.3
(2)
P
1036.6
(-2.5)
P
957.8
(-3)
P
1515.2
(0.5)
P
1716.1
(1.8)
P
942
B 1674
(1.6)
P
1681.1
(1.7)
P
1535.3
(0.4)
P
1452.6
(-0.3)
P
1139.1
(-3)
P
1834.8
(3)
P
696
C 2022.7
(3)
P
1339.1
(-1.7)
P
1179.7
(-2.8)
P
1397.1
(-1.3)
P
1151.3
(-3)
P
1741.6
(1.1)
P
871
avr 1865.6
(3)
1588.2
(0.3)
1250.5
(-3)
1269.2
(-2.8)
1268.5
(-2.8)
1764.2
(2)
615
No Scale

Warning: fopen(./gnuplot/171731_x_at_1_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/171731_x_at_1_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/171731_x_at_2_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/171731_x_at_2_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 518
1 2 3 4 range
A 683.2
(3)
P
293.2
(-1.6)
P
273.7
(-1.8)
P
171.3
(-3)
P
512
B 663.5
(3)
P
337.9
(-2.2)
P
285.7
(-3)
P
344.7
(-2.1)
P
378
C 689.1
(3)
P
361.9
(-1.3)
P
425
(-0.5)
P
234.5
(-3)
P
455
avr 678.6
(3)
331
(-1.9)
328.1
(-1.9)
250.2
(-3)
428

Warning: fopen(./gnuplot/171731_x_at_dNo_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/171731_x_at_dNo_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 524
1 2 3 4 5 6 range
A 350.2
(-1.1)
P
620.3
(3)
P
225.8
(-3)
P
242.9
(-2.7)
P
457.2
(0.5)
P
417.8
(-0.1)
P
394
B 582.5
(1)
P
559.6
(0.6)
P
372.8
(-3)
P
384.8
(-2.8)
P
462.8
(-1.3)
P
684.2
(3)
P
311
C 749.7
(3)
P
408.6
(-1.4)
P
300.2
(-2.8)
P
281
(-3)
P
372.6
(-1.8)
P
583
(0.9)
P
469
avr 560.8
(3)
529.5
(2.3)
299.6
(-3)
302.9
(-2.9)
430.9
(0)
561.7
(3)
262
NetAffx Links Cluster Members
Consensus/Exemplar
Group Members
GeneChip Array Information
Probe Set ID 171731_x_at
GeneChip Array C. elegans Genome Array
Organism Common Name Nematode
Probe Design Information
Transcript ID(Array Design) affy.Ce.20611
Sequence Type Exemplar sequence
Representative Public ID CEK044A9R NCBI
Target Description CEK044A9R_rc /REP_DB=TREMBL Accession /GB=D34307 /CHR=2 /FEA=Genomic Cluster /DEF=C.elegans cDNA clone yk44a9 : 3prime end, single read.
Cluster Evidence This cluster is supported by a Genomic Cluster.
Annotation Method Description
Annotation Description This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s).
Annotation Grade This is a grade A annotation.
Annotation Transcript Cluster (# of Matching Probes) NM_063278(11)
Transcript Assignments
Representative
Transcript
Description Matching Probes Related Probesets by Grade
NM_063278 NCBI Caenorhabditis elegans C08B11.3 (C08B11.3) mRNA, complete cds. 11/11 None
C08B11.3 ENSEMBL cdna:known chromosome:CEL140:II:8022556:8027667:-1 gene:C08B11.3 11/11 A 
Annotation Notes
There are no noteworthy cross hybridizing mRNAs found for this probe set.
Genomic Alignment of Consensus/Exemplar Sequence
Assembly Wormbase March 2004
Alignment(s)
Position Identity Coverage Cytoband
chrII:8022594-8022956(-) 100.0 100.0
Public Domain and Genome References
Gene Title Zinc finger, C2H2 type
Ensembl C08B11.3
Entrez Gene 174286 Entrez gene
SwissProt Q09441 EMBL-EBI
WormBase CE01473 Wormbase
Functional Annotations
Gene Ontology
GO Cellular Component (view graph)
ID Description Evidence Links
5622 intracellular inferred from electronic annotation QuickGO AmiGO
5634 nucleus inferred from electronic annotation QuickGO AmiGO
GO Molecular Function (view graph)
ID Description Evidence Links
3676 nucleic acid binding inferred from electronic annotation QuickGO AmiGO
3677 DNA binding inferred from electronic annotation QuickGO AmiGO
8270 zinc ion binding inferred from electronic annotation QuickGO AmiGO
Protein Similarities
Method ID Description E-Value
blast CAA86663 Hypothetical protein C08B11.3 [Caenorhabditis elegans] ref|NP_495679.1| C08B11.3 [Caenorhabditis elegans] sp|Q09441|YP83_CAEEL Hypothetical protein C08B11.3 in chromosome II 0.0
blast CAE67776 Hypothetical protein CBG13351 [Caenorhabditis briggsae] 0.0
blast NP_689854 AT rich interactive domain 2 (ARID, RFX-like) [Homo sapiens] sp|Q68CP9|ARID2_HUMAN AT-rich interactive domain-containing protein 2 (ARID domain-containing protein 2) (BRG1-associated factor 200) (BAF200) 5.0E-59
Protein Domains
Database ID Description E-Value
scop a.4.3.ARID domain All alpha proteins; DNA/RNA-binding 3-helical bundle; ARID-like; ARID domain 3.9999998989515E-5
Pfam IPR001606 EMBL-EBI ARID (AT-rich interaction domain) protein 3.7E-50
Sequence
Target Sequence
>C. ELEGANS:171731_X_AT
tttattccgtctcaccaattcataacctttttgtatttaatatattccaacgcggttgtc
tttaccttcaagaaactgaaaagatcttccacatcaccctcccttttccccatcatttat
cacttgtcgttcaaaactctaatttcgtattctgcaccaaacaagtggctatgtacgttt
ttcatcttgaaattcgtttttttttgtcaaatcagtctacatttcttttcccatgtatta
ctgaac


BLASTn GenBank NR
Probe Info
Probe Sequence(5'-3') Probe X Probe Y Probe Interrogation
Position
Strandedness
TTTATTCCGTCTCACCAATTCATAA 12 673 99 Antisense
CGTCTCACCAATTCATAACCTTTTT 342 245 106 Antisense
TATTCCAACGCGGTTGTCTTTACCT 640 661 141 Antisense
CTGAAAAGATCTTCCACATCACCCT 235 239 174 Antisense
TTTCCCCATCATTTATCACTTGTCG 20 671 203 Antisense
ATCACTTGTCGTTCAAAACTCTAAT 276 27 217 Antisense
AAACTCTAATTTCGTATTCTGCACC 377 127 232 Antisense
ATTCTGCACCAAACAAGTGGCTATG 295 11 247 Antisense
GTGGCTATGTACGTTTTTCATCTTG 375 491 263 Antisense
AAATCAGTCTACATTTCTTTTCCCA 438 113 307 Antisense
TTTCTTTTCCCATGTATTACTGAAC 68 673 320 Antisense
Sequence Source Affymetrix Proprietary Database