[Home] | [Total List]

[171729_x_at]

Description CEK074D4F /REP_DB=TREMBL Accession /5_PRIME_EXT_ID=B0286.4 /5_PRIME_EXT_DB=WormBase Gene ID /GB=D74058 /WB_GENE_ID=B0286.4 /WP=CE03864 /CHR=2 /FEA=Genomic Cluster /DEF=C.elegans cDNA clone yk74d4 : 5prime end, single read.
Cluster 6grp_highest_10_10 > 91      6grp_high1_10_10 > 39      4grp_highest_8_8 > 20      4grp_high_8_8 > 31      6grp_highest_nonorm > 76      6grp_total > 39      4grp_total > 32      6grp_cgc > 08      6grp_high1_sub > Cu      6grp_cgc_sub > Cu      6grp_total_sub > Cup      

Scale

Warning: fopen(./gnuplot/171729_x_at_1_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/171729_x_at_1_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/171729_x_at_2_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/171729_x_at_2_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 433
1 2 3 4 range
A 1400.9
(3)
P
1256.2
(-3)
P
1357
(1.2)
P
1378
(2.1)
P
145
B 1395.1
(-3)
P
1483.4
(-1.2)
P
1689.1
(3)
P
1586.9
(0.9)
P
294
C 1424.3
(-3)
P
1515.9
(3)
P
1492.1
(1.4)
P
1456.2
(-0.9)
P
92
avr 1406.8
(-3)
1418.5
(-2.3)
1512.7
(3)
1473.7
(0.8)
106

Warning: fopen(./gnuplot/171729_x_at_dSignal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/171729_x_at_dSignal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 577
1 2 3 4 5 6 range
A 1033.4
(-0.5)
P
1246.7
(3)
P
883.2
(-3)
P
958
(-1.8)
P
1000.9
(-1.1)
P
1189.9
(2.1)
P
364
B 1133.7
(3)
P
1010.2
(-1.3)
P
962.3
(-3)
P
1050.1
(0.1)
P
1104.5
(2)
P
1021
(-0.9)
P
171
C 1339.5
(3)
P
876.2
(-1.8)
P
969.6
(-0.8)
P
762.2
(-3)
P
1133.7
(0.9)
P
971.5
(-0.8)
P
577
avr 1168.9
(3)
1044.4
(-0)
938.4
(-2.6)
923.4
(-3)
1079.7
(0.8)
1060.8
(0.4)
246
No Scale

Warning: fopen(./gnuplot/171729_x_at_1_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/171729_x_at_1_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/171729_x_at_2_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/171729_x_at_2_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 318
1 2 3 4 range
A 510.1
(3)
P
272.7
(-1.6)
P
354.7
(-0)
P
201.7
(-3)
P
308
B 444.9
(3)
P
366.4
(-1.4)
P
391.4
(-0)
P
338.2
(-3)
P
107
C 471.5
(1.9)
P
435.8
(1.2)
P
520
(3)
P
245.5
(-3)
P
275
avr 475.5
(3)
358.3
(-0.3)
422
(1.5)
261.8
(-3)
214

Warning: fopen(./gnuplot/171729_x_at_dNo_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/171729_x_at_dNo_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 343
1 2 3 4 5 6 range
A 190.5
(-3)
P
443.4
(3)
P
192.3
(-3)
P
243
(-1.8)
P
302
(-0.4)
P
289.7
(-0.6)
P
253
B 394.5
(1.5)
P
336.3
(-0.1)
P
233.7
(-3)
P
278.1
(-1.8)
P
448.7
(3)
P
380.7
(1.1)
P
215
C 496.5
(3)
P
267.3
(-1)
P
246.8
(-1.4)
P
153.3
(-3)
P
366.9
(0.7)
P
325.2
(0)
P
343
avr 360.5
(2.5)
349
(2)
224.3
(-3)
224.8
(-3)
372.5
(3)
331.9
(1.4)
148
NetAffx Links Cluster Members
Consensus/Exemplar
Group Members
GeneChip Array Information
Probe Set ID 171729_x_at
GeneChip Array C. elegans Genome Array
Organism Common Name Nematode
Probe Design Information
Transcript ID(Array Design) affy.Ce.23539
Sequence Type Exemplar sequence
Representative Public ID CEK074D4F NCBI
Target Description CEK074D4F /REP_DB=TREMBL Accession /5_PRIME_EXT_ID=B0286.4 /5_PRIME_EXT_DB=WormBase Gene ID /GB=D74058 /WB_GENE_ID=B0286.4 /WP=CE03864 /CHR=2 /FEA=Genomic Cluster /DEF=C.elegans cDNA clone yk74d4 : 5prime end, single read.
Cluster Evidence This cluster is supported by a Genomic Cluster.
Annotation Method Description
Annotation Description This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s).
Annotation Grade This is a grade A annotation.
Annotation Transcript Cluster (# of Matching Probes) NM_062372(11)
Transcript Assignments
Representative
Transcript
Description Matching Probes Related Probesets by Grade
NM_062372 NCBI Caenorhabditis elegans NOT-Like (yeast CCR4/NOT complex component) family member (ntl-2) (ntl-2) mRNA, complete cds. 11/11 A 
B0286.4b ENSEMBL cdna:known chromosome:CEL140:II:4372734:4375016:-1 gene:B0286.4 11/11 A 
Annotation Notes
Cross Hybridizing mRNA Matched Probes Nature of Assignment Related Probesets by Grade
NM_062371 8/11 Cross Hyb Matching Probes A 
NM_062373 8/11 Cross Hyb Matching Probes A 
SNAP00000035726 8/11 Cross Hyb Matching Probes None
GENEFINDER00000035732 8/11 Cross Hyb Matching Probes None
B0286.4a.1 8/11 Cross Hyb Matching Probes None
B0286.4a.2 8/11 Cross Hyb Matching Probes None
B0286.4c.1 8/11 Cross Hyb Matching Probes A 
B0286.4c.2 8/11 Cross Hyb Matching Probes A 
B0286.4c.3 8/11 Cross Hyb Matching Probes A 
B0286.4c.4 8/11 Cross Hyb Matching Probes A 
Splice Variants
Entrez Total Refseq Isoforms Total Detected By This Probeset Refseq Probesets
173773 3 1 NM_062372 171729_x_at (11)
Genomic Alignment of Consensus/Exemplar Sequence
Assembly Wormbase March 2004
Alignment(s)
Position Identity Coverage Cytoband
chrII:4372753-4375704(-) 92.18 99.34
Public Domain and Genome References
Ensembl B0286.4
Functional Annotations
Protein Similarities
Method ID Description E-Value
blast AAL11099 Not-like (yeast ccr4/not complex component) protein 2, isoform b [Caenorhabditis elegans] ref|NP_494773.1| NOT-Like (yeast CCR4/NOT complex component) family member (ntl-2) [Caenorhabditis elegans] 0.0
blast AAA80691 Not-like (yeast ccr4/not complex component) protein 2, isoform a [Caenorhabditis elegans] ref|NP_494772.1| NOT-Like (yeast CCR4/NOT complex component) family member (ntl-2) [Caenorhabditis elegans] 0.0
blast AAL11100 Not-like (yeast ccr4/not complex component) protein 2, isoform c [Caenorhabditis elegans] ref|NP_494774.1| NOT-Like (yeast CCR4/NOT complex component) family member (ntl-2) [Caenorhabditis elegans] 1.0E-158
Protein Domains
Database ID Description E-Value
Pfam IPR007282 EMBL-EBI NOT2/NOT3/NOT5 5.4E-72
Sequence
Target Sequence
>C. ELEGANS:171729_X_AT
gttgacgcgttctcagtacggtggagtgaaagaacagacgggaaattatgaaaaagggca
ttacaacgtgttcgatcagatgcaatggcgaaaaattccgaaagagttaaagttggagta
caaagagctcgaggatcggccgaaaatgccgcaatcagtttccggacaaccgacacccta
caaatactttttccaaggaccacaatttccgagcggtccggagacgggtctgatgcttca
gatgcataacttgacgctcggcacaggtggcggcggtggcggacaaatcactccaccggc
accagcgggtcttaacggagttatgggtggtggtggtgttggagcagctggaatcggagg
aatcaatgtgcaaccgggagccgttccatcggcggcgcgagctactccaaactaaacaag
aagaagatgatctctcgtgtgcaaattttctatatcccactttcgtcatcttgttctcga
a


BLASTn GenBank NR
Probe Info
Probe Sequence(5'-3') Probe X Probe Y Probe Interrogation
Position
Strandedness
GTTGACGCGTTCTCAGTACGGTGGA 552 425 934 Antisense
TGCCGCAATCAGTTTCCGGACAACC 709 583 1080 Antisense
CCAAGGACCACAATTTCCGAGCGGT 101 263 1126 Antisense
GTCCGGAGACGGGTCTGATGCTTCA 680 475 1149 Antisense
GATGCATAACTTGACGCTCGGCACA 301 413 1174 Antisense
GGCGGTGGCGGACAAATCACTCCAC 375 541 1205 Antisense
GCACCAGCGGGTCTTAACGGAGTTA 73 315 1232 Antisense
AATGTGCAACCGGGAGCCGTTCCAT 266 163 1298 Antisense
GATGATCTCTCGTGTGCAAATTTTC 22 411 1359 Antisense
GCAAATTTTCTATATCCCACTTTCG 639 317 1374 Antisense
CCACTTTCGTCATCTTGTTCTCGAA 194 273 1390 Antisense
Sequence Source Affymetrix Proprietary Database