[Home] | [Total List]

[171728_x_at]

Description g2826834 /REP_DB=GenBank Identifier /CHR=5 /FEA=Genomic Cluster
Cluster 6grp_highest_10_10 > 50      6grp_high1_10_10 > 05      4grp_highest_8_8 > 47      4grp_high_8_8 > 11      6grp_highest_nonorm > 30      6grp_total > 06      4grp_total > 13      6grp_highest_sub > De      6grp_total_sub > Decrease      6grp_cgc > 22      6grp_high1_sub > De      6grp_cgc_sub > De      6grp_rule_based > S1      

Scale

Warning: fopen(./gnuplot/171728_x_at_1_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/171728_x_at_1_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/171728_x_at_2_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/171728_x_at_2_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 1585
1 2 3 4 range
A 1248.5
(0.7)
P
726.3
(-3)
P
798.5
(-2.5)
P
1577
(3)
P
851
B 1472.5
(0.4)
P
841
(-2)
P
582.9
(-3)
P
2167.4
(3)
P
1585
C 1540.1
(1.8)
P
1169.2
(-1.1)
P
920.3
(-3)
P
1698.4
(3)
P
778
avr 1420.4
(0.7)
912.2
(-2.2)
767.2
(-3)
1814.3
(3)
1047

Warning: fopen(./gnuplot/171728_x_at_dSignal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/171728_x_at_dSignal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 1872
1 2 3 4 5 6 range
A 1281.4
(2.6)
P
1340.9
(3)
P
843.3
(-0.2)
P
435.2
(-2.8)
P
602.2
(-1.8)
P
409.5
(-3)
P
931
B 1523.8
(3)
P
1232.6
(1.4)
P
791.2
(-1)
P
538.8
(-2.3)
P
570.2
(-2.2)
P
417.9
(-3)
P
1106
C 2255.6
(3)
P
914
(-1.3)
P
798
(-1.7)
P
383.6
(-3)
P
732.7
(-1.9)
P
444.2
(-2.8)
P
1872
avr 1686.9
(3)
1162.5
(0.5)
810.8
(-1.2)
452.5
(-2.9)
635
(-2)
423.9
(-3)
1263
No Scale

Warning: fopen(./gnuplot/171728_x_at_1_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/171728_x_at_1_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/171728_x_at_2_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/171728_x_at_2_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 375
1 2 3 4 range
A 454.6
(3)
P
157.7
(-3)
P
208.7
(-2)
P
230.8
(-1.5)
P
297
B 469.6
(3)
P
207.7
(-1.7)
P
135.1
(-3)
P
461.9
(2.9)
P
335
C 509.8
(3)
P
336.2
(-1.7)
P
320.8
(-2.1)
P
286.4
(-3)
P
223
avr 478
(3)
233.9
(-2.7)
221.5
(-3)
326.4
(-0.5)
257

Warning: fopen(./gnuplot/171728_x_at_dNo_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/171728_x_at_dNo_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 759
1 2 3 4 5 6 range
A 236.2
(-0.8)
P
476.9
(3)
P
183.7
(-1.7)
P
110.4
(-2.8)
P
181.7
(-1.7)
P
99.7
(-3)
P
377
B 530.2
(3)
P
410.3
(1.1)
P
192.1
(-2.2)
P
142.7
(-3)
P
231.7
(-1.6)
P
155.8
(-2.8)
P
388
C 836
(3)
P
278.9
(-1.4)
P
203.1
(-2)
P
77.1
(-3)
P
237.1
(-1.7)
P
148.7
(-2.4)
P
759
avr 534.1
(3)
388.7
(0.9)
193
(-1.8)
110.1
(-3)
216.8
(-1.5)
134.7
(-2.7)
424
NetAffx Links Cluster Members
Consensus/Exemplar
Group Members
GeneChip Array Information
Probe Set ID 171728_x_at
GeneChip Array C. elegans Genome Array
Organism Common Name Nematode
Probe Design Information
Transcript ID(Array Design) affy.Ce.21754
Sequence Type Exemplar sequence
Representative Public ID 2826834 NCBI
Target Description g2826834 /REP_DB=GenBank Identifier /CHR=5 /FEA=Genomic Cluster
Annotation Method Description
Annotation Description This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s).
Annotation Grade This is a grade A annotation.
Annotation Transcript Cluster (# of Matching Probes) NM_072014(11)
Transcript Assignments
Representative
Transcript
Description Matching Probes Related Probesets by Grade
NM_072014 NCBI Caenorhabditis elegans Na/Ca eXchangers family member (ncx-2) (ncx-2) mRNA, complete cds. 11/11 None
C10G8.5b ENSEMBL cdna:known chromosome:CEL140:V:5303501:5311058:1 gene:C10G8.5 11/11 A 
Annotation Notes
There are no noteworthy cross hybridizing mRNAs found for this probe set.
Splice Variants
Entrez Total Refseq Isoforms Total Detected By This Probeset Refseq Probesets
178918 4 1 NM_072014 171728_x_at (11)
Genomic Alignment of Consensus/Exemplar Sequence
Assembly Wormbase March 2004
Alignment(s)
Position Identity Coverage Cytoband
chrV:5310750-5311036(+) 62.94 100.0
Public Domain and Genome References
Ensembl C10G8.5
Functional Annotations
Protein Similarities
Method ID Description E-Value
blast AAM29661 Na/ca exchangers protein 2, isoform b [Caenorhabditis elegans] ref|NP_504415.2| Na/Ca eXchangers family member (ncx-2) [Caenorhabditis elegans] 0.0
blast CAA04574 sodium-calcium exchanger [Caenorhabditis elegans] 0.0
blast AAM29660 Na/ca exchangers protein 2, isoform a [Caenorhabditis elegans] ref|NP_504414.4| Na/Ca eXchangers family member (ncx-2) [Caenorhabditis elegans] 0.0
Protein Domains
Database ID Description E-Value
Pfam IPR004837 EMBL-EBI Sodium/calcium exchanger membrane region 1.7E-27
Pfam IPR004837 EMBL-EBI Sodium/calcium exchanger membrane region 5.0E-28
Pfam IPR003644 EMBL-EBI Na-Ca exchanger/integrin-beta4 1.0E-43
Pfam IPR003644 EMBL-EBI Na-Ca exchanger/integrin-beta4 5.7E-42
Trans Membrane
ID Number Of Domains Domain Boundaries
NP_504415.2 11 7-24,55-77,117-139,149-171,184-206,216-238,749-771,786-808,820-842,857-879,900-922
C10G8.5b 11 7-24,55-77,117-139,149-171,184-206,216-238,749-771,786-808,820-842,857-879,900-922
Sequence
Target Sequence
>C. ELEGANS:171728_X_AT
caaaacactgtttcttttctggtcgacaaaggtgcctaaatcgttttttctttttcactc
tcctcttccttctcctatttttcttgtttttctcactttgtgattatattttttttcctg
attttcttctgttttaatcttcactttttatccatttgaagttatatcataagattatca
atcttcctcgttgctttttgcatcaaatctttcattttcagttatttttcccctgct


BLASTn GenBank NR
Probe Info
Probe Sequence(5'-3') Probe X Probe Y Probe Interrogation
Position
Strandedness
CAAAACACTGTTTCTTTTCTGGTCG 661 189 24 Antisense
TCGACAAAGGTGCCTAAATCGTTTT 266 599 46 Antisense
TCCTATTTTTCTTGTTTTTCTCACT 182 593 96 Antisense
TTCTTGTTTTTCTCACTTTGTGATT 595 689 104 Antisense
GTGATTATATTTTTTTTCCTGATTT 163 485 123 Antisense
TTTCTTCTGTTTTAATCTTCACTTT 653 671 146 Antisense
TAATCTTCACTTTTTATCCATTTGA 672 635 158 Antisense
AGATTATCAATCTTCCTCGTTGCTT 598 65 195 Antisense
TCTTCCTCGTTGCTTTTTGCATCAA 639 617 205 Antisense
GTTGCTTTTTGCATCAAATCTTTCA 359 439 213 Antisense
CATTTTCAGTTATTTTTCCCCTGCT 289 215 236 Antisense
Sequence Source GenBank