[Home] | [Total List]

[171727_x_at] Cytochrome P450

Description AV181762_rc /REP_DB=TREMBL Accession /GB=AV181762 /CHR=2 /FEA=Genomic Cluster /DEF=Caenorhabditis elegans cDNA clone:yk624e3 : 3prime end, single read.
Cluster 6grp_high1_10_10 > 91      4grp_high_8_8 > 46      6grp_total > 92      4grp_total > 56      6grp_cgc > 98      6grp_high1_sub > 05      6grp_rule_based > S5      4grp_rule_based > L3      

Scale

Warning: fopen(./gnuplot/171727_x_at_1_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/171727_x_at_1_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/171727_x_at_2_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/171727_x_at_2_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 116
1 2 3 4 range
A 36.3
(-2.6)
A
112.2
(1.9)
P
130.2
(3)
P
29.4
(-3)
A
101
B 42
(-2.8)
A
97
(0.9)
A
127.5
(3)
P
38.8
(-3)
A
89
C 51.4
(-3)
P
145.4
(3)
P
144.9
(3)
P
70.2
(-1.8)
P
94
avr 43.2
(-3)
118.2
(1.9)
134.2
(3)
46.1
(-2.8)
91

Warning: fopen(./gnuplot/171727_x_at_dSignal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/171727_x_at_dSignal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 449
1 2 3 4 5 6 range
A 94.8
(-2.4)
A
82.4
(-2.6)
P
159.3
(-1.3)
P
279.6
(0.6)
P
429.2
(3)
P
55.9
(-3)
A
373
B 120.8
(-2.7)
P
126.2
(-2.6)
P
127
(-2.6)
P
273.2
(-0.4)
P
504.4
(3)
P
98.5
(-3)
P
406
C 84
(-3)
P
104.2
(-2.5)
P
93.6
(-2.8)
A
260.5
(1.5)
P
318.6
(3)
P
95
(-2.7)
P
235
avr 99.9
(-2.7)
104.3
(-2.6)
126.6
(-2.2)
271.1
(0.4)
417.4
(3)
83.1
(-3)
334
No Scale

Warning: fopen(./gnuplot/171727_x_at_1_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/171727_x_at_1_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/171727_x_at_2_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/171727_x_at_2_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 46
1 2 3 4 range
A 13.2
(-1.2)
A
24.4
(1.1)
P
34
(3)
P
4.3
(-3)
A
30
B 13.4
(-1.6)
A
24
(1.4)
A
29.6
(3)
P
8.3
(-3)
A
21
C 17
(-2.2)
P
41.8
(1.7)
P
50.5
(3)
P
11.8
(-3)
P
39
avr 14.5
(-1.7)
30.1
(1.4)
38
(3)
8.1
(-3)
30

Warning: fopen(./gnuplot/171727_x_at_dNo_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/171727_x_at_dNo_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 191
1 2 3 4 5 6 range
A 17.5
(-2.8)
A
29.3
(-2.2)
P
34.7
(-1.9)
P
70.9
(-0)
P
129.5
(3)
P
13.6
(-3)
A
116
B 42
(-2.6)
P
42
(-2.6)
P
30.8
(-3)
P
72.4
(-1.6)
P
204.9
(3)
P
36.7
(-2.8)
P
174
C 31.2
(-2.4)
P
31.8
(-2.4)
P
23.8
(-3)
A
52.4
(-0.8)
P
103.1
(3)
P
31.8
(-2.4)
P
79
avr 30.2
(-2.9)
34.4
(-2.6)
29.8
(-2.9)
65.2
(-1.1)
145.8
(3)
27.4
(-3)
118
NetAffx Links Cluster Members
Consensus/Exemplar
Group Members
GeneChip Array Information
Probe Set ID 171727_x_at
GeneChip Array C. elegans Genome Array
Organism Common Name Nematode
Probe Design Information
Transcript ID(Array Design) affy.Ce.20668
Sequence Type Exemplar sequence
Representative Public ID AV181762 NCBI
Target Description AV181762_rc /REP_DB=TREMBL Accession /GB=AV181762 /CHR=2 /FEA=Genomic Cluster /DEF=Caenorhabditis elegans cDNA clone:yk624e3 : 3prime end, single read.
Cluster Evidence This cluster is supported by a Genomic Cluster.
Annotation Method Description
Annotation Description This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s).
Annotation Grade This is a grade A annotation.
Annotation Transcript Cluster (# of Matching Probes) NM_062396(11)
Transcript Assignments
Representative
Transcript
Description Matching Probes Related Probesets by Grade
NM_062396 NCBI Caenorhabditis elegans CYtochrome P450 family member (cyp-23A1) (cyp-23A1) mRNA, complete cds. 11/11 None
SNAP00000018301 ENSEMBL cdna:SNAP chromosome:CEL140:II:4510241:4516021:1 11/11 None
GENEFINDER00000018312 ENSEMBL cdna:GeneFinder chromosome:CEL140:II:4512497:4516240:1 9/11 None
B0304.3 ENSEMBL cdna:known chromosome:CEL140:II:4512198:4516102:1 gene:B0304.3 11/11 None
Annotation Notes
There are no noteworthy cross hybridizing mRNAs found for this probe set.
Genomic Alignment of Consensus/Exemplar Sequence
Assembly Wormbase March 2004
Alignment(s)
Position Identity Coverage Cytoband
chrII:4515326-4516045(+) 100.0 100.0
Public Domain and Genome References
Gene Title Cytochrome P450
Gene Symbol cyp-23A1
Ensembl B0304.3
Entrez Gene 173787 Entrez gene
SwissProt Q27465 EMBL-EBI
WormBase CE27050 Wormbase
Functional Annotations
Ortholog
ID Title Organism
MU11KSUBA:U62294_S_AT cytochrome P450, family 2, subfamily j, polypeptide 5 mm
MG-U74AV2:92814_AT cytochrome P450, family 2, subfamily j, polypeptide 5 mm
MOE430A:1417532_AT cytochrome P450, family 2, subfamily j, polypeptide 5 mm
MOUSE430A_2:1417532_AT cytochrome P450, family 2, subfamily j, polypeptide 5 mm
MOUSE430_2:1417532_AT cytochrome P450, family 2, subfamily j, polypeptide 5 mm
MOE430A:1417531_AT cytochrome P450, family 2, subfamily j, polypeptide 5 mm
MOUSE430A_2:1417531_AT cytochrome P450, family 2, subfamily j, polypeptide 5 mm
MOUSE430_2:1417531_AT cytochrome P450, family 2, subfamily j, polypeptide 5 mm
MU19KSUBA:TC24654_I_AT Cytochrome P450, family 2, subfamily j, polypeptide 5, mRNA (cDNA clone MGC:13729 IMAGE:4161995) mm
MU19KSUBC:TC38837_S_AT Cytochrome P450, family 2, subfamily j, polypeptide 5, mRNA (cDNA clone MGC:13729 IMAGE:4161995) mm
MU19KSUBC:TC40773_AT Cytochrome P450, family 2, subfamily j, polypeptide 5, mRNA (cDNA clone MGC:13729 IMAGE:4161995) mm
MU19KSUBC:TC40773_G_AT Cytochrome P450, family 2, subfamily j, polypeptide 5, mRNA (cDNA clone MGC:13729 IMAGE:4161995) mm
Gene Ontology
GO Biological Process (view graph)
ID Description Evidence Links
6118 electron transport inferred from electronic annotation QuickGO AmiGO
GO Molecular Function (view graph)
ID Description Evidence Links
4497 monooxygenase activity inferred from electronic annotation QuickGO AmiGO
Protein Similarities
Method ID Description E-Value
blast AAK31395 Cytochrome p450 family protein 23A1 [Caenorhabditis elegans] ref|NP_494797.1| CYtochrome P450 family member (cyp-23A1) [Caenorhabditis elegans] 0.0
blast T15318 hypothetical protein B0304.3 - Caenorhabditis elegans 0.0
blast CAE67878 Hypothetical protein CBG13471 [Caenorhabditis briggsae] 0.0
Protein Families
Method ID Description E-Value
p450 CP1B_MOUSE Animalia; CYP1B-1; mou; CP1B_MOUSE; Mus musculus; Q64429 1.0E-130
p450 CP1B_MOUSE Animalia; CYP1B-1; mou; CP1B_MOUSE; Mus musculus; Q64429 1.0E-128
p450 CP1B_MOUSE Animalia; CYP1B-1; mou; CP1B_MOUSE; Mus musculus; Q64429 1.0E-131
Protein Domains
Database ID Description E-Value
Pfam IPR001128 EMBL-EBI Cytochrome P450 3.1E-111
Pfam IPR001128 EMBL-EBI Cytochrome P450 3.1E-111
Pfam IPR001128 EMBL-EBI Cytochrome P450 3.1E-111
Trans Membrane
ID Number Of Domains Domain Boundaries
NP_494797.1 3 7-24,30-47,89-111
B0304.3 3 7-24,30-47,89-111
SNAP00000018301 1 31-50
Sequence
Target Sequence
>C. ELEGANS:171727_X_AT
tcaatccatcgcggtttttggatgaagataataatgtgaaaaagattgacgaatttctac
cattttcaattggaaggaggcaatgtttaggagaatcattggctcgggcagagttgtacc
tggtttttgcaaatttaatacaaaatttcaattttgaagtggcggatgatgtgacgactg
agcgagttctcggtctaacagtgtctcccgttgaatattcttgtaaaatcacacgacgag
gtttggatcacaatcagaattctg


BLASTn GenBank NR
Probe Info
Probe Sequence(5'-3') Probe X Probe Y Probe Interrogation
Position
Strandedness
TCAATCCATCGCGGTTTTTGGATGA 676 631 13 Antisense
GATTGACGAATTTCTACCATTTTCA 279 429 56 Antisense
GAGAATCATTGGCTCGGGCAGAGTT 119 391 103 Antisense
GGGCAGAGTTGTACCTGGTTTTTGC 570 493 118 Antisense
GAAGTGGCGGATGATGTGACGACTG 576 335 168 Antisense
GTGACGACTGAGCGAGTTCTCGGTC 164 483 183 Antisense
GAGTTCTCGGTCTAACAGTGTCTCC 109 399 196 Antisense
CAGTGTCTCCCGTTGAATATTCTTG 171 209 211 Antisense
ATATTCTTGTAAAATCACACGACGA 575 17 227 Antisense
TCACACGACGAGGTTTGGATCACAA 394 625 241 Antisense
GGTTTGGATCACAATCAGAATTCTG 418 505 252 Antisense
Sequence Source Affymetrix Proprietary Database