[Home] | [Total List]

[171726_x_at]

Description CEK102A3R_rc /REP_DB=TREMBL Accession /GB=D66524 /CHR=5 /FEA=Genomic Cluster /DEF=C.elegans cDNA clone yk102a3 : 3prime end, single read.
Cluster 6grp_high1_10_10 > 28      4grp_high_8_8 > 25      6grp_total > 18      4grp_total > 38      6grp_high1_sub > De      6grp_total_sub > Decrease      6grp_rule_based > S1      

Scale

Warning: fopen(./gnuplot/171726_x_at_1_Signal.dat): failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/171726_x_at_1_Signal.gnu): failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/171726_x_at_2_Signal.dat): failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/171726_x_at_2_Signal.gnu): failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 316
1 2 3 4 range
A 448.3
(3)
P
229.3
(-2.1)
P
189.3
(-3)
P
301.6
(-0.4)
P
259
B 484.8
(3)
P
201.1
(-2.5)
M
175.2
(-3)
A
345.5
(0.3)
P
310
C 491.2
(3)
P
302.3
(-0.9)
P
198.2
(-3)
P
237.6
(-2.2)
P
293
avr 474.8
(3)
244.2
(-1.8)
187.6
(-3)
294.9
(-0.8)
287

Warning: fopen(./gnuplot/171726_x_at_dSignal.dat): failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/171726_x_at_dSignal.gnu): failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 722
1 2 3 4 5 6 range
A 533.7
(3)
P
330.4
(-0.5)
P
282.1
(-1.3)
P
180.9
(-3)
P
331.7
(-0.4)
P
266.4
(-1.5)
P
353
B 903.1
(3)
P
426.8
(-1.2)
P
237.8
(-2.9)
P
309.4
(-2.2)
P
222.5
(-3)
P
376.3
(-1.6)
P
681
C 558.6
(3)
P
354.9
(-0.3)
P
187.7
(-3)
P
249.4
(-2)
A
231.5
(-2.3)
P
283.4
(-1.5)
P
371
avr 665.1
(3)
370.7
(-1.1)
235.9
(-3)
246.6
(-2.9)
261.9
(-2.6)
308.7
(-2)
429
No Scale

Warning: fopen(./gnuplot/171726_x_at_1_No_Signal.dat): failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/171726_x_at_1_No_Signal.gnu): failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/171726_x_at_2_No_Signal.dat): failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/171726_x_at_2_No_Signal.gnu): failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 123
1 2 3 4 range
A 163.2
(3)
P
49.8
(-2.7)
P
49.5
(-2.7)
P
44.1
(-3)
P
119
B 154.6
(3)
P
49.7
(-2.5)
M
40.6
(-3)
A
73.6
(-1.3)
P
114
C 162.6
(3)
P
86.9
(-0.7)
P
69.1
(-1.6)
P
40.1
(-3)
P
123
avr 160.1
(3)
62.1
(-2.5)
53.1
(-3)
52.6
(-3)
108

Warning: fopen(./gnuplot/171726_x_at_dNo_Signal.dat): failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/171726_x_at_dNo_Signal.gnu): failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 268
1 2 3 4 5 6 range
A 98.4
(1.4)
P
117.5
(3)
P
61.4
(-1.7)
P
45.9
(-3)
P
100.1
(1.5)
P
64.9
(-1.4)
P
72
B 314.2
(3)
P
142.1
(-1)
P
57.7
(-3)
P
82
(-2.4)
P
90.4
(-2.2)
P
140.3
(-1.1)
P
257
C 207
(3)
P
108.3
(-0.7)
P
47.8
(-3)
P
50.1
(-2.9)
A
74.9
(-2)
P
94.9
(-1.2)
P
159
avr 206.5
(3)
122.6
(-0.3)
55.6
(-3)
59.3
(-2.9)
88.5
(-1.7)
100
(-1.2)
151
NetAffx Links Cluster Members
Consensus/Exemplar
Group Members
GeneChip Array Information
Probe Set ID 171726_x_at
GeneChip Array C. elegans Genome Array
Organism Common Name Nematode
Probe Design Information
Transcript ID(Array Design) affy.Ce.21842
Sequence Type Exemplar sequence
Representative Public ID CEK102A3R NCBI
Target Description CEK102A3R_rc /REP_DB=TREMBL Accession /GB=D66524 /CHR=5 /FEA=Genomic Cluster /DEF=C.elegans cDNA clone yk102a3 : 3prime end, single read.
Cluster Evidence This cluster is supported by a Genomic Cluster.
Annotation Method Description
Annotation Description Only library file information is available for this probe set. See probe design information above.
Transcript Assignments
Representative
Transcript
Description Matching Probes Related Probesets by Grade
Y59A8B.1a ENSEMBL cdna:known chromosome:CEL140:V:17938908:17951604:-1 gene:Y59A8B.1 11/11 None
Annotation Notes
There are no noteworthy cross hybridizing mRNAs found for this probe set.
Genomic Alignment of Consensus/Exemplar Sequence
Assembly Wormbase March 2004
Alignment(s)
Position Identity Coverage Cytoband
chrV:17938917-17939232(-) 100.0 100.0
Public Domain and Genome References
Ensembl Y59A8B.1
Functional Annotations
Protein Similarities
Method ID Description E-Value
blast CAC14406 Hypothetical protein Y59A8B.1a [Caenorhabditis elegans] ref|NP_001024266.1| DumPY : shorter than wild-type family member (dpy-21) [Caenorhabditis elegans] 0.0
blast CAE61695 Hypothetical protein CBG05643 [Caenorhabditis briggsae] 3.0E-89
blast XP_614755 PREDICTED: similar to round spermatid basic protein 1-like isoform 1 [Bos taurus] 2.0E-71
Sequence
Target Sequence
>C. ELEGANS:171726_X_AT
tcatcatattgtcatttgcaaatctttcatggattcgattccccccacctgcaaaaatac
agaaaatctcatttttttacctctttcccactgaaatttgggcatttctcttcttttttt
gttggaaaaattggcttttttttcaatcttttttcatgttttactgatctctgtcccccc
gtctttatgtctgtttttgat


BLASTn GenBank NR
Probe Info
Probe Sequence(5'-3') Probe X Probe Y Probe Interrogation
Position
Strandedness
TCATCATATTGTCATTTGCAAATCT 115 621 13 Antisense
TTGTCATTTGCAAATCTTTCATGGA 397 707 21 Antisense
AATCTTTCATGGATTCGATTCCCCC 187 171 33 Antisense
TTCCCCCCACCTGCAAAAATACAGA 391 663 51 Antisense
CAGAAAATCTCATTTTTTTACCTCT 216 205 72 Antisense
TTTACCTCTTTCCCACTGAAATTTG 89 673 88 Antisense
GAAATTTGGGCATTTCTCTTCTTTT 431 363 105 Antisense
GCATTTCTCTTCTTTTTTTGTTGGA 542 307 114 Antisense
GCTTTTTTTTCAATCTTTTTTCATG 382 305 146 Antisense
TTCATGTTTTACTGATCTCTGTCCC 232 689 165 Antisense
CCCCGTCTTTATGTCTGTTTTTGAT 476 259 189 Antisense
Sequence Source Affymetrix Proprietary Database