[Home] | [Total List]

[171725_x_at] collagen

Description CEK070BXF /REP_DB=TREMBL Accession /5_PRIME_EXT_ID=F57B1.4 /5_PRIME_EXT_DB=WormBase Gene ID /GB=D69451 /WB_GENE_ID=F57B1.4 /WP=CE11292 /CHR=5 /FEA=Genomic Cluster /DEF=collagen; C.elegans cDNA clone yk70b10 : 5prime end, single read.
Cluster 6grp_highest_10_10 > 25      6grp_high1_10_10 > 42      4grp_highest_8_8 > 16      4grp_high_8_8 > 61      6grp_highest_nonorm > 09      6grp_total > 31      4grp_total > 59      6grp_highest_sub > 03      6grp_cgc > 73      6grp_high1_sub > 02_03      6grp_cgc_sub > 02_03      6grp_total_sub > Hat      6grp_rule_based > S3      4grp_rule_based > L3      

Scale

Warning: fopen(./gnuplot/171725_x_at_1_Signal.dat): failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/171725_x_at_1_Signal.gnu): failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/171725_x_at_2_Signal.dat): failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/171725_x_at_2_Signal.gnu): failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 28122
1 2 3 4 range
A 17297.6
(0.6)
P
26303.7
(2.6)
P
28107.6
(3)
P
619.2
(-3)
P
27488
B 17693.5
(0.7)
P
27051.2
(2.7)
P
28476.9
(3)
P
443.6
(-3)
P
28033
C 15673.4
(1.4)
P
21406.1
(3)
P
20944.4
(2.9)
P
355.4
(-3)
P
21051
avr 16888.2
(0.9)
24920.3
(2.8)
25843
(3)
472.7
(-3)
25370

Warning: fopen(./gnuplot/171725_x_at_dSignal.dat): failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/171725_x_at_dSignal.gnu): failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 21928
1 2 3 4 5 6 range
A 19262.2
(-1)
P
30592.6
(2.9)
P
30833.5
(3)
P
27679.4
(1.9)
P
21462
(-0.2)
P
13281.2
(-3)
P
17552
B 17690.9
(-1)
P
26240
(1.8)
P
29980.7
(3)
P
22669.4
(0.6)
P
18567.5
(-0.7)
P
11590.1
(-3)
P
18391
C 17564.3
(-1.1)
P
28290.1
(1.8)
P
32717.5
(3)
P
23648.7
(0.5)
P
24037.6
(0.6)
P
10790
(-3)
P
21928
avr 18172.5
(-1)
28374.2
(2.1)
31177.2
(3)
24665.8
(1)
21355.7
(-0.1)
11887.1
(-3)
19290
No Scale

Warning: fopen(./gnuplot/171725_x_at_1_No_Signal.dat): failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/171725_x_at_1_No_Signal.gnu): failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/171725_x_at_2_No_Signal.dat): failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/171725_x_at_2_No_Signal.gnu): failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 7288
1 2 3 4 range
A 6298.1
(2.1)
P
5709.8
(1.6)
P
7347.9
(3)
P
90.6
(-3)
P
7257
B 5642.3
(2.1)
P
6681
(3)
P
6598.7
(2.9)
P
94.5
(-3)
P
6587
C 5188.3
(1.3)
P
6154.4
(2.1)
P
7299.8
(3)
P
59.9
(-3)
P
7240
avr 5709.6
(1.8)
6181.7
(2.2)
7082.1
(3)
81.7
(-3)
7000

Warning: fopen(./gnuplot/171725_x_at_dNo_Signal.dat): failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/171725_x_at_dNo_Signal.gnu): failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 7647
1 2 3 4 5 6 range
A 3550.8
(-2.8)
P
10880.2
(3)
P
6714.9
(-0.3)
P
7020.1
(-0)
P
6476.3
(-0.5)
P
3233.6
(-3)
P
7647
B 6155.6
(-0.5)
P
8734.2
(3)
P
7280.2
(1)
P
6004.3
(-0.7)
P
7543.7
(1.4)
P
4321.9
(-3)
P
4412
C 6510.3
(0.5)
P
8632.2
(3)
P
8327.2
(2.6)
P
4755.8
(-1.6)
P
7778.2
(2)
P
3612
(-3)
P
5020
avr 5405.6
(-1.2)
9415.5
(3)
7440.8
(0.9)
5926.7
(-0.7)
7266.1
(0.7)
3722.5
(-3)
5693
NetAffx Links Cluster Members
Consensus/Exemplar
Group Members
GeneChip Array Information
Probe Set ID 171725_x_at
GeneChip Array C. elegans Genome Array
Organism Common Name Nematode
Probe Design Information
Transcript ID(Array Design) affy.Ce.25558
Sequence Type Exemplar sequence
Representative Public ID CEK070BXF NCBI
Target Description CEK070BXF /REP_DB=TREMBL Accession /5_PRIME_EXT_ID=F57B1.4 /5_PRIME_EXT_DB=WormBase Gene ID /GB=D69451 /WB_GENE_ID=F57B1.4 /WP=CE11292 /CHR=5 /FEA=Genomic Cluster /DEF=collagen; C.elegans cDNA clone yk70b10 : 5prime end, single read.
Cluster Evidence This cluster is supported by a Genomic Cluster.
Annotation Method Description
Annotation Description This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s).
Annotation Grade This is a grade A annotation.
Annotation Transcript Cluster (# of Matching Probes) NM_073883(11)
Transcript Assignments
Representative
Transcript
Description Matching Probes Related Probesets by Grade
NM_073883 NCBI Caenorhabditis elegans F57B1.4 (collagen) mRNA, complete cds. 11/11 A 
F57B1.4.1 ENSEMBL cdna:known chromosome:CEL140:V:13203578:13204780:-1 gene:F57B1.4 11/11 A 
F57B1.4.3 ENSEMBL cdna:known chromosome:CEL140:V:13203578:13204690:-1 gene:F57B1.4 11/11 None
F57B1.4.2 ENSEMBL cdna:known chromosome:CEL140:V:13203578:13204780:-1 gene:F57B1.4 11/11 A 
Annotation Notes
Cross Hybridizing mRNA Matched Probes Nature of Assignment Related Probesets by Grade
NM_073276 3/11 Cross Hyb Matching Probes A 
NM_073277 3/11 Cross Hyb Matching Probes A 
NM_059689 1/11 Cross Hyb Matching Probes A 
NM_059690 1/11 Cross Hyb Matching Probes A 
NM_070565 1/11 Cross Hyb Matching Probes A 
NM_073512 1/11 Cross Hyb Matching Probes A 
NM_075994 1/11 Cross Hyb Matching Probes None
NM_073882 6/11 Cross Hyb Matching Probes A 
NM_069714 1/11 Cross Hyb Matching Probes A 
NM_171361 1/11 Cross Hyb Matching Probes None
NM_072673 1/11 Cross Hyb Matching Probes A 
NM_073245 1/11 Cross Hyb Matching Probes A 
SNAP00000007970 1/11 Cross Hyb Matching Probes None
GENEFINDER00000007974 1/11 Cross Hyb Matching Probes None
SNAP00000007971 1/11 Cross Hyb Matching Probes None
GENEFINDER00000007980 1/11 Cross Hyb Matching Probes None
GENEFINDER00000044434 1/11 Cross Hyb Matching Probes None
SNAP00000044426 1/11 Cross Hyb Matching Probes None
SNAP00000000185 1/11 Cross Hyb Matching Probes None
GENEFINDER00000000214 1/11 Cross Hyb Matching Probes None
SNAP00000005950 1/11 Cross Hyb Matching Probes None
SNAP00000005951 1/11 Cross Hyb Matching Probes None
GENEFINDER00000005959 1/11 Cross Hyb Matching Probes None
GENEFINDER00000005960 1/11 Cross Hyb Matching Probes None
SNAP00000032051 1/11 Cross Hyb Matching Probes None
GENEFINDER00000032086 1/11 Cross Hyb Matching Probes None
SNAP00000002816 3/11 Cross Hyb Matching Probes None
SNAP00000002817 3/11 Cross Hyb Matching Probes None
GENEFINDER00000002822 3/11 Cross Hyb Matching Probes None
GENEFINDER00000002824 3/11 Cross Hyb Matching Probes None
SNAP00000007051 5/11 Cross Hyb Matching Probes None
SNAP00000007052 8/11 Cross Hyb Matching Probes None
GENEFINDER00000007058 5/11 Cross Hyb Matching Probes None
GENEFINDER00000007063 8/11 Cross Hyb Matching Probes None
SNAP00000013927 1/11 Cross Hyb Matching Probes None
GENEFINDER00000013944 1/11 Cross Hyb Matching Probes None
SNAP00000025313 1/11 Cross Hyb Matching Probes None
GENEFINDER00000025319 1/11 Cross Hyb Matching Probes None
SNAP00000027127 1/11 Cross Hyb Matching Probes None
GENEFINDER00000027152 1/11 Cross Hyb Matching Probes None
C15A11.5 1/11 Cross Hyb Matching Probes A 
C15A11.6 1/11 Cross Hyb Matching Probes A 
Y73B6BL.34 1/11 Cross Hyb Matching Probes None
F54D1.2 1/11 Cross Hyb Matching Probes R A 
Y51H4A.9 1/11 Cross Hyb Matching Probes A 
ZC513.8 1/11 Cross Hyb Matching Probes A 
B0024.1 1/11 Cross Hyb Matching Probes R A 
F15H10.2 3/11 Cross Hyb Matching Probes A 
F15H10.1.2 3/11 Cross Hyb Matching Probes A 
F15H10.1.1 3/11 Cross Hyb Matching Probes A 
T11F9.9 1/11 Cross Hyb Matching Probes R A 
F57B1.3 6/11 Cross Hyb Matching Probes A 
Genomic Alignment of Consensus/Exemplar Sequence
Assembly Wormbase March 2004
Alignment(s)
Position Identity Coverage Cytoband
chrV:13203596-13204941(-) 89.6 100.0
chrV:13200912-13201831(-) 62.8 73.11
Public Domain and Genome References
Gene Title collagen
Gene Symbol col-160
Ensembl F57B1.4
Entrez Gene 179804 Entrez gene
SwissProt Q20921 EMBL-EBI
WormBase CE31962 Wormbase
Functional Annotations
Gene Ontology
GO Biological Process (view graph)
ID Description Evidence Links
6817 phosphate transport inferred from electronic annotation QuickGO AmiGO
GO Cellular Component (view graph)
ID Description Evidence Links
5737 cytoplasm inferred from electronic annotation QuickGO AmiGO
GO Molecular Function (view graph)
ID Description Evidence Links
42302 structural constituent of cuticle inferred from electronic annotation QuickGO AmiGO
Protein Similarities
Method ID Description E-Value
blast CAB01508 Hypothetical protein F57B1.4 [Caenorhabditis elegans] ref|NP_506284.2| F57B1.4 [Caenorhabditis elegans] 9.0E-59
blast CAB01509 Hypothetical protein F57B1.3 [Caenorhabditis elegans] ref|NP_506283.1| F57B1.3 [Caenorhabditis elegans] 9.0E-54
blast CAA98257 Hypothetical protein F15H10.1 [Caenorhabditis elegans] ref|NP_505678.1| F15H10.1 [Caenorhabditis elegans] sp|P20630|COL12_CAEEL Cuticle collagen 12 precursor emb|CAA35954.1| collagen [Caenorhabditis elegans] 1.0E-46
Protein Domains
Database ID Description E-Value
Pfam IPR002486 EMBL-EBI Nematode cuticle collagen, N-terminal 2.5E-12
Pfam IPR008160 EMBL-EBI Collagen triple helix repeat 4.6E-4
Pfam IPR008160 EMBL-EBI Collagen triple helix repeat 5.2E-12
Pfam IPR008160 EMBL-EBI Collagen triple helix repeat 8.4E-7
Trans Membrane
ID Number Of Domains Domain Boundaries
NP_506284.2 1 20-42
F57B1.4.1 1 20-42
F57B1.4.3 1 20-42
F57B1.4.2 1 20-42
Sequence
Target Sequence
>C. ELEGANS:171725_X_AT
aaccgctggaccagacagcttctgcttcgactgcccagctggaccaccaggaccatcagg
agccccaggacaaaagggaccttcaggagccccaggagccccaggacaatccggaggagc
ttcccttccaggaccaccaggaccagccggaccaccaggaccatctggacaaccaggatc
caacggaaacgccggagccccaggagccccaggacaagtcgtcgatgttccaggaacccc
aggaccagctggaccaccaggaccaccaggaccagccggagccccaggacagccaggaca
atctggatccgctcaaccaggaggcccaggaccacaaggagatgccggagctccaggagc
cccaggacaaccaggacaagctggagccccaggacaagacggagacagcggatccgaggg
agcttgcgatcactgcccaccaccacgtaccgccccaggatattaaatgtatccgaattg
attatgacatcatttctctcacttccattatcttgctttat


BLASTn GenBank NR
Probe Info
Probe Sequence(5'-3') Probe X Probe Y Probe Interrogation
Position
Strandedness
AACCGCTGGACCAGACAGCTTCTGC 348 147 619 Antisense
CAAAAGGGACCTTCAGGAGCCCCAG 43 191 689 Antisense
AGCCCCAGGACAATCCGGAGGAGCT 441 83 715 Antisense
GGACCACCAGGACCATCTGGACAAC 368 523 767 Antisense
GCCCCAGGACAAGTCGTCGATGTTC 623 285 824 Antisense
ATCTGGATCCGCTCAACCAGGAGGC 306 33 919 Antisense
GAGGCCCAGGACCACAAGGAGATGC 268 405 939 Antisense
GACAGCGGATCCGAGGGAGCTTGCG 691 367 1022 Antisense
CACGTACCGCCCCAGGATATTAAAT 371 199 1062 Antisense
TTATGACATCATTTCTCTCACTTCC 524 681 1100 Antisense
TCTCACTTCCATTATCTTGCTTTAT 598 613 1115 Antisense
Sequence Source Affymetrix Proprietary Database