[Home] | [Total List]

[171724_x_at] protein phosphatase

Description AV178012_rc /REP_DB=TREMBL Accession /GB=AV178012 /CHR=1 /FEA=Genomic Cluster /DEF=Caenorhabditis elegans cDNA clone:yk536g8 : 3prime end, single read.
Cluster 6grp_highest_10_10 > 78      6grp_high1_10_10 > 88      4grp_highest_8_8 > 21      4grp_high_8_8 > 15      6grp_highest_nonorm > 94      6grp_total > 88      4grp_total > 08      6grp_highest_sub > In      6grp_cgc > 59      6grp_high1_sub > Da      6grp_cgc_sub > Da      6grp_total_sub > Increase      6grp_rule_based > S6      4grp_rule_based > L4      

Scale

Warning: fopen(./gnuplot/171724_x_at_1_Signal.dat): failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/171724_x_at_1_Signal.gnu): failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/171724_x_at_2_Signal.dat): failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/171724_x_at_2_Signal.gnu): failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 287
1 2 3 4 range
A 190.7
(-1.3)
P
141.9
(-3)
P
239.8
(0.5)
P
310.8
(3)
P
169
B 174.8
(-3)
P
179.8
(-2.8)
P
185.6
(-2.6)
P
351.6
(3)
P
177
C 106.7
(-3)
P
144.1
(-2.2)
P
219.9
(-0.6)
P
393.5
(3)
P
287
avr 157.4
(-2.9)
155.3
(-3)
215.1
(-1.2)
352
(3)
197

Warning: fopen(./gnuplot/171724_x_at_dSignal.dat): failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/171724_x_at_dSignal.gnu): failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 1182
1 2 3 4 5 6 range
A 137
(-2.8)
P
99
(-3)
P
203.4
(-2.4)
P
189.5
(-2.4)
P
724
(0.8)
P
1075.6
(3)
P
977
B 120.3
(-3)
P
130.1
(-2.9)
P
144.9
(-2.9)
P
254
(-2.3)
P
601.5
(-0.5)
P
1278.1
(3)
P
1158
C 96.1
(-3)
P
128
(-2.8)
P
175.2
(-2.6)
P
236.9
(-2.3)
P
617.5
(-0.3)
P
1275.2
(3)
P
1179
avr 117.8
(-3)
119
(-3)
174.5
(-2.7)
226.8
(-2.4)
647.7
(-0.1)
1209.6
(3)
1092
No Scale

Warning: fopen(./gnuplot/171724_x_at_1_No_Signal.dat): failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/171724_x_at_1_No_Signal.gnu): failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/171724_x_at_2_No_Signal.dat): failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/171724_x_at_2_No_Signal.gnu): failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 46
1 2 3 4 range
A 69.4
(3)
P
30.8
(-3)
P
62.7
(2)
P
45.5
(-0.7)
P
39
B 55.7
(-0.6)
P
44.4
(-2.7)
P
43
(-3)
P
74.9
(3)
P
32
C 35.3
(-3)
P
41.4
(-2.1)
P
76.6
(3)
P
66.3
(1.5)
P
41
avr 53.5
(0.8)
38.9
(-3)
60.8
(2.6)
62.2
(3)
23

Warning: fopen(./gnuplot/171724_x_at_dNo_Signal.dat): failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/171724_x_at_dNo_Signal.gnu): failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 451
1 2 3 4 5 6 range
A 25.3
(-3)
P
35.2
(-2.7)
P
44.3
(-2.5)
P
48.1
(-2.4)
P
218.5
(1.9)
P
261.9
(3)
P
237
B 41.9
(-2.9)
P
43.3
(-2.9)
P
35.2
(-3)
P
67.3
(-2.6)
P
244.4
(-0.2)
P
476.6
(3)
P
441
C 35.6
(-3)
P
39.1
(-2.9)
P
44.6
(-2.9)
P
47.6
(-2.8)
P
199.8
(-0.5)
P
426.9
(3)
P
391
avr 34.3
(-3)
39.2
(-2.9)
41.4
(-2.9)
54.3
(-2.7)
220.9
(0.2)
388.5
(3)
354
NetAffx Links Cluster Members
Consensus/Exemplar
Group Members
GeneChip Array Information
Probe Set ID 171724_x_at
GeneChip Array C. elegans Genome Array
Organism Common Name Nematode
Probe Design Information
Transcript ID(Array Design) affy.Ce.20249
Sequence Type Exemplar sequence
Representative Public ID AV178012 NCBI
Target Description AV178012_rc /REP_DB=TREMBL Accession /GB=AV178012 /CHR=1 /FEA=Genomic Cluster /DEF=Caenorhabditis elegans cDNA clone:yk536g8 : 3prime end, single read.
Cluster Evidence This cluster is supported by a Genomic Cluster.
Annotation Method Description
Annotation Description This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s).
Annotation Grade This is a grade A annotation.
Annotation Transcript Cluster (# of Matching Probes) NM_059461(11)
Transcript Assignments
Representative
Transcript
Description Matching Probes Related Probesets by Grade
NM_059461 NCBI Caenorhabditis elegans Cell Division Cycle related family member (cdc-25.1) (cdc-25.1) mRNA, complete cds. 11/11 None
K06A5.7.2 ENSEMBL cdna:known chromosome:CEL140:I:6477521:6480086:-1 gene:K06A5.7 11/11 None
K06A5.7.1 ENSEMBL cdna:known chromosome:CEL140:I:6477521:6480057:-1 gene:K06A5.7 11/11 None
Annotation Notes
There are no noteworthy cross hybridizing mRNAs found for this probe set.
Genomic Alignment of Consensus/Exemplar Sequence
Assembly Wormbase March 2004
Alignment(s)
Position Identity Coverage Cytoband
chrI:6477517-6477817(-) 100.0 100.0
Public Domain and Genome References
Gene Title protein phosphatase
Gene Symbol cdc-25.1
Ensembl K06A5.7
Entrez Gene 172353 Entrez gene
SwissProt O44552 EMBL-EBI
WormBase CE11778 Wormbase
Functional Annotations
Gene Ontology
GO Biological Process (view graph)
ID Description Evidence Links
87 M phase of mitotic cell cycle inferred from electronic annotation QuickGO AmiGO
6470 protein amino acid dephosphorylation inferred from electronic annotation QuickGO AmiGO
GO Cellular Component (view graph)
ID Description Evidence Links
5622 intracellular inferred from electronic annotation QuickGO AmiGO
5634 nucleus inferred from direct assay QuickGO AmiGO
GO Molecular Function (view graph)
ID Description Evidence Links
4725 protein tyrosine phosphatase activity inferred from electronic annotation QuickGO AmiGO
4721 phosphoprotein phosphatase activity inferred from sequence similarity QuickGO AmiGO
Protein Similarities
Method ID Description E-Value
blast AAK29711 Cell division cycle related protein 25.1 [Caenorhabditis elegans] ref|NP_491862.1| Cell Division Cycle related family member (cdc-25.1) [Caenorhabditis elegans] sp|O44552|MPIP1_CAEEL M-phase inducer phosphatase cdc-25.1 (Cell division cycle related protein 25.1) 0.0
blast CAE67200 Hypothetical protein CBG12636 [Caenorhabditis briggsae] 0.0
blast CAA88725 Hypothetical protein R05H5.2 [Caenorhabditis elegans] ref|NP_496197.1| Cell Division Cycle related family member (cdc-25.4) [Caenorhabditis elegans] 4.0E-34
Protein Domains
Database ID Description E-Value
Pfam IPR001763 EMBL-EBI Rhodanese-like 4.4E-18
Sequence
Target Sequence
>C. ELEGANS:171724_X_AT
tcgtttctttttctattttgagtcacactttgcaggtctccgtttcgactggttcctctt
ctaccaacccattcttttaaatcagtcccttcttggtctctaagcaatgtggcttcattg
caatacgcttccaagactgaagggttttttttttaactcacgccttatgcctaggtcatc
tatctaatagttgtcaaacaaactactcagtcactgaggatctttaactctcta


BLASTn GenBank NR
Probe Info
Probe Sequence(5'-3') Probe X Probe Y Probe Interrogation
Position
Strandedness
TCGTTTCTTTTTCTATTTTGAGTCA 197 603 46 Antisense
ATTTTGAGTCACACTTTGCAGGTCT 627 13 60 Antisense
TCTACCAACCCATTCTTTTAAATCA 505 607 105 Antisense
TTTAAATCAGTCCCTTCTTGGTCTC 421 673 121 Antisense
TCCCTTCTTGGTCTCTAAGCAATGT 483 597 131 Antisense
TGGTCTCTAAGCAATGTGGCTTCAT 112 553 139 Antisense
GTGGCTTCATTGCAATACGCTTCCA 495 489 154 Antisense
TTAACTCACGCCTTATGCCTAGGTC 232 641 198 Antisense
GCCTTATGCCTAGGTCATCTATCTA 526 281 207 Antisense
GTCAAACAAACTACTCAGTCACTGA 126 465 238 Antisense
GTCACTGAGGATCTTTAACTCTCTA 633 465 255 Antisense
Sequence Source Affymetrix Proprietary Database