[Home] | [Total List]

[171723_x_at]

Description CEC7564 /REP_DB=TREMBL Accession /5_PRIME_EXT_ID=F59D8.B /5_PRIME_EXT_DB=WormBase Gene ID /GB=C11756 /WB_GENE_ID=F59D8.B /WP=CE20901 /CHR=X /FEA=Genomic Cluster /DEF=(ST.LOUIS) protein_id:AAF35967.1; C.elegans cDNA clone yk122a10 : 5prime end, single read.
Cluster 6grp_total > 99      4grp_total > 24      6grp_cgc > 79      6grp_cgc_sub > Da      6grp_total_sub > Increase      6grp_rule_based > S5      4grp_rule_based > L4      

Scale

Warning: fopen(./gnuplot/171723_x_at_1_Signal.dat): failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/171723_x_at_1_Signal.gnu): failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/171723_x_at_2_Signal.dat): failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/171723_x_at_2_Signal.gnu): failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 175
1 2 3 4 range
A 26.3
(-3)
A
53.2
(-2)
A
105.9
(-0.1)
A
193.2
(3)
P
167
B 28.2
(-3)
A
105.9
(3)
A
102.2
(2.7)
A
99.7
(2.5)
M
78
C 18.3
(-3)
A
76.3
(-0.6)
A
111.4
(0.9)
P
160.8
(3)
P
143
avr 24.3
(-3)
78.5
(-0.4)
106.5
(0.9)
151.2
(3)
127

Warning: fopen(./gnuplot/171723_x_at_dSignal.dat): failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/171723_x_at_dSignal.gnu): failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 7747
1 2 3 4 5 6 range
A 26.7
(-3)
A
78.1
(-3)
A
39.1
(-3)
A
69.7
(-3)
A
7549
(3)
P
5598.3
(1.4)
P
7522
B 67.7
(-2.9)
A
29.7
(-3)
A
6.8
(-3)
A
66.3
(-2.9)
A
5780.3
(2.7)
P
6086.7
(3)
P
6080
C 59
(-3)
A
62.4
(-3)
A
7
(-3)
A
53.1
(-3)
A
7753.4
(3)
P
5975.6
(1.6)
P
7746
avr 51.1
(-3)
56.7
(-3)
17.6
(-3)
63
(-3)
7027.6
(3)
5886.9
(2)
7010
No Scale

Warning: fopen(./gnuplot/171723_x_at_1_No_Signal.dat): failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/171723_x_at_1_No_Signal.gnu): failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/171723_x_at_2_No_Signal.dat): failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/171723_x_at_2_No_Signal.gnu): failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 33
1 2 3 4 range
A 9.6
(-3)
A
11.5
(-2.4)
A
27.7
(2.8)
A
28.3
(3)
P
19
B 9
(-3)
A
26.2
(3)
A
23.7
(2.1)
A
21.3
(1.3)
M
17
C 6.1
(-3)
A
21.9
(-0.1)
A
38.8
(3)
P
27.1
(0.9)
P
33
avr 8.2
(-3)
19.9
(0.2)
30.1
(3)
25.6
(1.8)
22

Warning: fopen(./gnuplot/171723_x_at_dNo_Signal.dat): failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/171723_x_at_dNo_Signal.gnu): failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 2507
1 2 3 4 5 6 range
A 4.9
(-3)
A
27.8
(-2.9)
A
8.5
(-3)
A
17.7
(-3)
A
2278
(3)
P
1363
(0.6)
P
2273
B 23.5
(-2.9)
A
9.9
(-3)
A
1.6
(-3)
A
17.6
(-3)
A
2348.5
(3)
P
2269.7
(2.8)
P
2347
C 21.9
(-3)
A
19
(-3)
A
1.8
(-3)
A
10.7
(-3)
A
2508.9
(3)
P
2000.4
(1.8)
P
2507
avr 16.8
(-3)
18.9
(-3)
4
(-3)
15.3
(-3)
2378.5
(3)
1877.7
(1.7)
2375
NetAffx Links Cluster Members
Consensus/Exemplar
Group Members
GeneChip Array Information
Probe Set ID 171723_x_at
GeneChip Array C. elegans Genome Array
Organism Common Name Nematode
Probe Design Information
Transcript ID(Array Design) affy.Ce.26172
Sequence Type Exemplar sequence
Representative Public ID CEC7564 NCBI
Target Description CEC7564 /REP_DB=TREMBL Accession /5_PRIME_EXT_ID=F59D8.B /5_PRIME_EXT_DB=WormBase Gene ID /GB=C11756 /WB_GENE_ID=F59D8.B /WP=CE20901 /CHR=X /FEA=Genomic Cluster /DEF=(ST.LOUIS) protein_id:AAF35967.1; C.elegans cDNA clone yk122a10 : 5prime end, single read.
Cluster Evidence This cluster is supported by a Genomic Cluster.
Annotation Method Description
Annotation Description This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s).
Annotation Grade This is a grade A annotation.
Annotation Transcript Cluster (# of Matching Probes) NM_076211(10)
Transcript Assignments
Representative
Transcript
Description Matching Probes Related Probesets by Grade
NM_076211 NCBI Caenorhabditis elegans VITellogenin structural genes (yolk protein genes) family member (vit-4) (vit-4) mRNA, complete cds. 10/11 A 
SNAP00000036909 ENSEMBL cdna:SNAP chromosome:CEL140:X:3558880:3564326:-1 10/11 None
GENEFINDER00000036913 ENSEMBL cdna:GeneFinder chromosome:CEL140:X:3558966:3564326:-1 9/11 None
F59D8.2 ENSEMBL cdna:known chromosome:CEL140:X:3558850:3563952:-1 gene:F59D8.2 10/11 A 
Annotation Notes
Cross Hybridizing mRNA Matched Probes Nature of Assignment Related Probesets by Grade
NM_076212 6/11 Cross Hyb Matching Probes A 
NM_076188 7/11 Cross Hyb Matching Probes A 
SNAP00000016179 6/11 Cross Hyb Matching Probes None
GENEFINDER00000016190 6/11 Cross Hyb Matching Probes None
GENEFINDER00000029426 7/11 Cross Hyb Matching Probes None
SNAP00000029419 7/11 Cross Hyb Matching Probes None
C04F6.1 7/11 Cross Hyb Matching Probes A 
F59D8.1.2 6/11 Cross Hyb Matching Probes A 
F59D8.1.1 6/11 Cross Hyb Matching Probes A 
F59D8.1.3 6/11 Cross Hyb Matching Probes None
Genomic Alignment of Consensus/Exemplar Sequence
Assembly Wormbase March 2004
Alignment(s)
Position Identity Coverage Cytoband
chrX:3403457-3408542(+) 92.24 92.24
chrX:3558881-3564328(-) 100.0 100.0
chrX:3567446-3571257(-) 68.47 68.47
Public Domain and Genome References
Gene Title
Gene Symbol vit-4
Ensembl F59D8.2
Entrez Gene 180646 Entrez gene
SwissProt P18947 EMBL-EBI
WormBase CE26817 Wormbase
Functional Annotations
Ortholog
ID Title Organism
CHICKEN:GGA.4125.1.S1_AT vitellogenin I gga
HG-U133_PLUS_2:239061_AT tetra-peptide repeat homeobox-like hs
HG-U133B:239061_AT tetra-peptide repeat homeobox-like hs
U133_X3P:HS.216699.0.A1_3P_AT tetra-peptide repeat homeobox-like hs
HG-U95E:71466_AT tetra-peptide repeat homeobox-like hs
Gene Ontology
GO Biological Process (view graph)
ID Description Evidence Links
6869 lipid transport inferred from electronic annotation QuickGO AmiGO
GO Molecular Function (view graph)
ID Description Evidence Links
5319 lipid transporter activity inferred from electronic annotation QuickGO AmiGO
Protein Similarities
Method ID Description E-Value
blast AAK09074 Vitellogenin structural genes (yolk protein genes) protein 4 [Caenorhabditis elegans] ref|NP_508612.1| VITellogenin structural genes (yolk protein genes) family member (vit-4) [Caenorhabditis elegans] sp|P18947|VIT4_CAEEL Vitellogenin 4 precursor 0.0
blast AAK09075 Vitellogenin structural genes (yolk protein genes) protein 3 [Caenorhabditis elegans] ref|NP_508613.1| VITellogenin structural genes (yolk protein genes) family member (vit-3) [Caenorhabditis elegans] sp|Q9N4J2|VIT3_CAEEL Vitellogenin 3 precursor 0.0
blast AAA83587 Vitellogenin structural genes (yolk protein genes) protein 5 [Caenorhabditis elegans] ref|NP_508589.1| VITellogenin structural genes (yolk protein genes) family member (vit-5) [Caenorhabditis elegans] 0.0
Protein Domains
Database ID Description E-Value
Pfam IPR001846 EMBL-EBI von Willebrand factor, type D 7.2E-42
Pfam IPR001747 EMBL-EBI Lipid transport protein, N-terminal 1.0E-126
Pfam IPR001846 EMBL-EBI von Willebrand factor, type D 7.2E-42
Pfam IPR001747 EMBL-EBI Lipid transport protein, N-terminal 1.0E-126
Pfam IPR001846 EMBL-EBI von Willebrand factor, type D 7.2E-42
Pfam IPR001747 EMBL-EBI Lipid transport protein, N-terminal 1.0E-126
Trans Membrane
ID Number Of Domains Domain Boundaries
SNAP00000036909 1 84-106
GENEFINDER00000036913 1 96-118
Sequence
Target Sequence
>C. ELEGANS:171723_X_AT
accttattgttattcgtcttccacatggagaggttcgtttcgatggatacactgtcaaga
ccaacatgccatccgttgcttcacaaaaccaactttgcggactttgcggaaacaatgacg
gtgagagagacaatgagttcatgaccgctgacaactacgaaactgaggatgttgaggaat
tccaccgctcttaccttctcaagaacgaggaatgcgaagttgagaaagaccgcatctccg
agaagaagaactacaaaaacaaatggaacagagaagagaagaagtccgactacgagagca
gctccgactacgagagcaactacgatgaaaaggaaactgagaaggaactcgtcaagaaga
ccctcatcaaggagttctccaaccgcgtctgcttctccatcgagccagtctctgagtgcc
gccgtggactcgaatccgagaagacttccaacaagaagatccgtttcacttgcatgccac
gccacagcaagaacgcccgccgtttcttgaaggaggcccgtgagcaaaccgtcgccgact
tggtcgatttcccagtctcctttgttgagtctg


BLASTn GenBank NR
Probe Info
Probe Sequence(5'-3') Probe X Probe Y Probe Interrogation
Position
Strandedness
ACCTTATTGTTATTCGTCTTCCACA 566 87 4524 Antisense
GGTTCGTTTCGATGGATACACTGTC 612 503 4555 Antisense
AAGACCAACATGCCATCCGTTGCTT 691 153 4580 Antisense
GTTCATGACCGCTGACAACTACGAA 62 445 4660 Antisense
GGATGTTGAGGAATTCCACCGCTCT 304 513 4690 Antisense
CCGCTCTTACCTTCTCAAGAACGAG 317 263 4708 Antisense
AGAAGTCCGACTACGAGAGCAGCTC 347 75 4803 Antisense
GGAACTCGTCAAGAAGACCCTCATC 390 529 4867 Antisense
GACCCTCATCAAGGAGTTCTCCAAC 42 383 4882 Antisense
AAGAAGATCCGTTTCACTTGCATGC 63 153 4976 Antisense
TTCCCAGTCTCCTTTGTTGAGTCTG 578 697 5072 Antisense
Sequence Source Affymetrix Proprietary Database