[Home] | [Total List]

[171722_x_at]

Description AV189310 /REP_DB=TREMBL Accession /5_PRIME_EXT_ID=F56B3.11A /5_PRIME_EXT_DB=WormBase Gene ID /GB=AV189310 /WB_GENE_ID=F56B3.11A /WP=CE25907 /CHR=4 /FEA=Genomic Cluster /DEF=Caenorhabditis elegans cDNA clone:yk534f7 : 5prime end, single read.
Cluster 6grp_highest_10_10 > 23      6grp_high1_10_10 > 20      4grp_highest_8_8 > 13      4grp_high_8_8 > 30      6grp_highest_nonorm > 67      6grp_total > 34      4grp_total > 24      6grp_highest_sub > 01_02_03      6grp_total_sub > Decrease      4grp_rule_based > L4      

Scale

Warning: fopen(./gnuplot/171722_x_at_1_Signal.dat): failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/171722_x_at_1_Signal.gnu): failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/171722_x_at_2_Signal.dat): failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/171722_x_at_2_Signal.gnu): failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 1645
1 2 3 4 range
A 1968.3
(-3)
P
2301.5
(-1.8)
P
2866
(0.3)
P
3613.4
(3)
P
1645
B 1981.2
(-3)
P
2820
(0.5)
P
3330.1
(2.6)
P
3431.6
(3)
P
1450
C 2050.6
(-3)
P
2788
(0.2)
P
2736.6
(-0.1)
P
3451.1
(3)
P
1401
avr 2000
(-3)
2636.5
(-0.5)
2977.6
(0.9)
3498.7
(3)
1499

Warning: fopen(./gnuplot/171722_x_at_dSignal.dat): failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/171722_x_at_dSignal.gnu): failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 855
1 2 3 4 5 6 range
A 2070.7
(1.9)
P
1844
(0.2)
P
2225.4
(3)
P
1863.3
(0.4)
P
1404.6
(-3)
P
1498.1
(-2.3)
P
821
B 1942.2
(1.7)
P
2078
(3)
P
1999.8
(2.3)
P
1852.1
(0.8)
P
1450.5
(-3)
P
1618.2
(-1.4)
P
628
C 1681.4
(0.4)
P
1890.9
(2.6)
P
1923.7
(3)
P
1635
(-0.1)
P
1370
(-3)
P
1728.2
(0.9)
P
554
avr 1898.1
(1.6)
1937.6
(2)
2049.6
(3)
1783.5
(0.5)
1408.4
(-3)
1614.8
(-1.1)
641
No Scale

Warning: fopen(./gnuplot/171722_x_at_1_No_Signal.dat): failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/171722_x_at_1_No_Signal.gnu): failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/171722_x_at_2_No_Signal.dat): failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/171722_x_at_2_No_Signal.gnu): failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 454
1 2 3 4 range
A 716.6
(2.2)
P
499.6
(-3)
P
749.2
(3)
P
528.9
(-2.3)
P
250
B 631.8
(-3)
P
696.5
(-0.2)
P
771.7
(3)
P
731.3
(1.3)
P
140
C 678.8
(-1.4)
P
801.6
(0.5)
P
953.8
(3)
P
581.9
(-3)
P
372
avr 675.7
(-1.2)
665.9
(-1.5)
824.9
(3)
614
(-3)
211

Warning: fopen(./gnuplot/171722_x_at_dNo_Signal.dat): failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/171722_x_at_dNo_Signal.gnu): failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 363
1 2 3 4 5 6 range
A 381.7
(-2.6)
P
655.8
(3)
P
484.6
(-0.5)
P
472.6
(-0.8)
P
423.9
(-1.8)
P
364.7
(-3)
P
291
B 675.8
(2.5)
P
691.7
(3)
P
485.6
(-3)
P
490.6
(-2.9)
P
589.3
(0)
P
603.4
(0.4)
P
206
C 623.2
(3)
P
577
(2.1)
P
489.6
(0.3)
P
328.8
(-3)
P
443.3
(-0.7)
P
578.5
(2.1)
P
294
avr 560.2
(0.7)
641.5
(3)
486.6
(-1.4)
430.7
(-3)
485.5
(-1.4)
515.5
(-0.6)
211
NetAffx Links Cluster Members
Consensus/Exemplar
Group Members
GeneChip Array Information
Probe Set ID 171722_x_at
GeneChip Array C. elegans Genome Array
Organism Common Name Nematode
Probe Design Information
Transcript ID(Array Design) affy.Ce.25068
Sequence Type Exemplar sequence
Representative Public ID AV189310 NCBI
Target Description AV189310 /REP_DB=TREMBL Accession /5_PRIME_EXT_ID=F56B3.11A /5_PRIME_EXT_DB=WormBase Gene ID /GB=AV189310 /WB_GENE_ID=F56B3.11A /WP=CE25907 /CHR=4 /FEA=Genomic Cluster /DEF=Caenorhabditis elegans cDNA clone:yk534f7 : 5prime end, single read.
Cluster Evidence This cluster is supported by a Genomic Cluster.
Annotation Method Description
Annotation Description This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s).
Annotation Grade This is a grade A annotation.
Annotation Transcript Cluster (# of Matching Probes) NM_067590(10), NM_067591(10)
Transcript Assignments
Representative
Transcript
Description Matching Probes Related Probesets by Grade
NM_067590 NCBI Caenorhabditis elegans F56B3.11a (F56B3.11) mRNA, complete cds. 10/11 A 
NM_067591 NCBI Caenorhabditis elegans F56B3.11b (F56B3.11) mRNA, complete cds. 10/11 A 
SNAP00000041569 ENSEMBL cdna:SNAP chromosome:CEL140:IV:794752:796459:-1 9/11 None
GENEFINDER00000041581 ENSEMBL cdna:GeneFinder chromosome:CEL140:IV:795818:796562:-1 10/11 None
F56B3.11a ENSEMBL cdna:known chromosome:CEL140:IV:795806:796562:-1 gene:F56B3.11 10/11 A 
F56B3.11b ENSEMBL cdna:known chromosome:CEL140:IV:795824:796562:-1 gene:F56B3.11 10/11 A 
Annotation Notes
There are no noteworthy cross hybridizing mRNAs found for this probe set.
Genomic Alignment of Consensus/Exemplar Sequence
Assembly Wormbase March 2004
Alignment(s)
Position Identity Coverage Cytoband
chrIV:795824-796569(-) 100.0 100.0
Public Domain and Genome References
Ensembl F56B3.11
Functional Annotations
Protein Similarities
Method ID Description E-Value
blast F88632 protein F56B3.4 [imported] - Caenorhabditis elegans 1.0E-159
blast AAK29831 Hypothetical protein F56B3.11a [Caenorhabditis elegans] ref|NP_499991.1| F56B3.11a [Caenorhabditis elegans] 1.0E-119
blast F88632 protein F56B3.4 [imported] - Caenorhabditis elegans 1.0E-107
blast AAK29832 Hypothetical protein F56B3.11b [Caenorhabditis elegans] ref|NP_499992.1| F56B3.11b [Caenorhabditis elegans] 1.0E-104
blast CAE56267 Hypothetical protein CBG23912 [Caenorhabditis briggsae] 1.0E-101
Protein Domains
Database ID Description E-Value
Pfam IPR001232 EMBL-EBI SKP1 component 7.5E-24
Pfam IPR001232 EMBL-EBI SKP1 component 4.6E-14
Trans Membrane
ID Number Of Domains Domain Boundaries
NP_499991.1 1 81-103
NP_499992.1 1 81-103
F56B3.11a 1 81-103
F56B3.11b 1 81-103
SNAP00000041569 1 63-85
GENEFINDER00000041581 1 81-103
Sequence
Target Sequence
>C. ELEGANS:171722_X_AT
ggaacatgcgctccagagatcgattttggaggaagttttggtgcatgagaaggcgaaacc
gacgacatttggcggaaaagtcgctgaaaaggcgtcgaacacgtttatgtacacggcagt
tgtcgctggaatcggtctaattggtgcatttatctatgtgctcgccggggaatttttcgc
tcaagattccccgcagacaattttcaatagagctctcgcattggtacgtgatgatggccg
ttgtcaggaaatattcggcgcctcaatcgccggattcggcgaggaaacgtcacgtggacg
ccgccgccacgtggcacatcacaagtacgagaaggacggaatgcagcggattcgggtgct
tttccacgtgaaaggagaccgagatgagggaattgctcaagctgaaatggagcaacgaga
cggagattggcagtggcggttcttgtatgt


BLASTn GenBank NR
Probe Info
Probe Sequence(5'-3') Probe X Probe Y Probe Interrogation
Position
Strandedness
GGAACATGCGCTCCAGAGATCGATT 253 529 154 Antisense
GTACACGGCAGTTGTCGCTGGAATC 25 461 262 Antisense
GGTGCATTTATCTATGTGCTCGCCG 517 501 296 Antisense
TCGCCGGGGAATTTTTCGCTCAAGA 642 593 315 Antisense
GATTCCCCGCAGACAATTTTCAATA 249 433 338 Antisense
TAGAGCTCTCGCATTGGTACGTGAT 443 653 361 Antisense
GGTACGTGATGATGGCCGTTGTCAG 62 503 376 Antisense
TATTCGGCGCCTCAATCGCCGGATT 559 659 405 Antisense
CGCCACGTGGCACATCACAAGTACG 308 257 458 Antisense
AATGCAGCGGATTCGGGTGCTTTTC 591 163 493 Antisense
ATTGGCAGTGGCGGTTCTTGTATGT 242 3 579 Antisense
Sequence Source Affymetrix Proprietary Database