[Home] | [Total List]

[171721_x_at]

Description g6767 /REP_DB=GenBank Identifier /5_PRIME_EXT_ID=T01G9.2B /5_PRIME_EXT_DB=WormBase Gene ID /WB_GENE_ID=T01G9.2B /WP=CE23937 /CHR=1 /FEA=Genomic Cluster
Cluster 6grp_highest_10_10 > 57      6grp_high1_10_10 > 84      4grp_highest_8_8 > 55      4grp_high_8_8 > 20      6grp_highest_nonorm > 67      6grp_total > 75      4grp_total > 20      

Scale

Warning: fopen(./gnuplot/171721_x_at_1_Signal.dat): failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/171721_x_at_1_Signal.gnu): failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/171721_x_at_2_Signal.dat): failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/171721_x_at_2_Signal.gnu): failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 529
1 2 3 4 range
A 1381.2
(-0.8)
P
1678.6
(3)
P
1214.8
(-3)
P
1622.6
(2.3)
P
464
B 1524.6
(0.1)
P
1461.2
(-0.8)
P
1291.8
(-3)
P
1743.9
(3)
P
452
C 1487.6
(0.7)
P
1299.6
(-3)
P
1328.8
(-2.4)
P
1602.6
(3)
P
303
avr 1464.5
(-0)
1479.8
(0.2)
1278.5
(-3)
1656.4
(3)
378

Warning: fopen(./gnuplot/171721_x_at_dSignal.dat): failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/171721_x_at_dSignal.gnu): failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 703
1 2 3 4 5 6 range
A 1906
(3)
P
1523.8
(-3)
P
1781.2
(1)
P
1848.1
(2.1)
P
1874.2
(2.5)
P
1779.7
(1)
P
382
B 1724.6
(0.2)
P
1411.2
(-3)
P
1987
(2.9)
P
1794.5
(0.9)
P
1697.4
(-0.1)
P
1997.1
(3)
P
586
C 1621.6
(-0.6)
P
1345.7
(-3)
P
1687.5
(-0.1)
P
1755.5
(0.5)
P
1466.3
(-2)
P
2048.4
(3)
P
703
avr 1750.7
(0.8)
1426.9
(-3)
1818.6
(1.6)
1799.4
(1.3)
1679.3
(-0.1)
1941.7
(3)
515
No Scale

Warning: fopen(./gnuplot/171721_x_at_1_No_Signal.dat): failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/171721_x_at_1_No_Signal.gnu): failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/171721_x_at_2_No_Signal.dat): failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/171721_x_at_2_No_Signal.gnu): failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 265
1 2 3 4 range
A 502.9
(3)
P
364.4
(-0.1)
P
317.6
(-1.2)
P
237.5
(-3)
P
265
B 486.2
(3)
P
360.9
(-1)
P
299.3
(-3)
P
371.6
(-0.7)
P
187
C 492.4
(3)
P
373.6
(-0.2)
P
463.1
(2.2)
P
270.2
(-3)
P
222
avr 493.8
(3)
366.3
(-0.8)
360
(-1)
293.1
(-3)
201

Warning: fopen(./gnuplot/171721_x_at_dNo_Signal.dat): failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/171721_x_at_dNo_Signal.gnu): failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 393
1 2 3 4 5 6 range
A 351.4
(-3)
P
541.9
(2.3)
P
387.9
(-2)
P
468.7
(0.3)
P
565.6
(3)
P
433.3
(-0.7)
P
214
B 600.1
(-0.2)
P
469.7
(-3)
P
482.5
(-2.7)
P
475.3
(-2.9)
P
689.6
(1.8)
P
744.7
(3)
P
275
C 601.1
(1.5)
P
410.6
(-2)
P
429.5
(-1.6)
P
353
(-3)
P
474.5
(-0.8)
P
685.7
(3)
P
333
avr 517.5
(-0.3)
474.1
(-1.7)
433.3
(-3)
432.3
(-3)
576.6
(1.6)
621.2
(3)
189
NetAffx Links Cluster Members
Consensus/Exemplar
Group Members
GeneChip Array Information
Probe Set ID 171721_x_at
GeneChip Array C. elegans Genome Array
Organism Common Name Nematode
Probe Design Information
Transcript ID(Array Design) affy.Ce.22856
Sequence Type Exemplar sequence
Representative Public ID 6767 NCBI
Target Description g6767 /REP_DB=GenBank Identifier /5_PRIME_EXT_ID=T01G9.2B /5_PRIME_EXT_DB=WormBase Gene ID /WB_GENE_ID=T01G9.2B /WP=CE23937 /CHR=1 /FEA=Genomic Cluster
Annotation Method Description
Annotation Description This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s).
Annotation Grade This is a grade A annotation.
Annotation Transcript Cluster (# of Matching Probes) NM_059851(10), NM_171841(10)
Transcript Assignments
Representative
Transcript
Description Matching Probes Related Probesets by Grade
NM_059851 NCBI Caenorhabditis elegans T01G9.2b (T01G9.2) mRNA, complete cds. 10/11 None
NM_171841 NCBI Caenorhabditis elegans T01G9.2a (T01G9.2) mRNA, complete cds. 10/11 A 
T01G9.2b.1 ENSEMBL cdna:known chromosome:CEL140:I:8283772:8296248:-1 gene:T01G9.2 10/11 None
T01G9.2b.2 ENSEMBL cdna:known chromosome:CEL140:I:8283813:8296250:-1 gene:T01G9.2 10/11 None
T01G9.2a ENSEMBL cdna:known chromosome:CEL140:I:8284008:8296248:-1 gene:T01G9.2 10/11 A 
Annotation Notes
Cross Hybridizing mRNA Matched Probes Nature of Assignment Related Probesets by Grade
SNAP00000040990 2/11 Cross Hyb Matching Probes None
GENEFINDER00000040999 6/11 Cross Hyb Matching Probes None
SNAP00000040993 4/11 Cross Hyb Matching Probes None
GENEFINDER00000041000 4/11 Cross Hyb Matching Probes None
Genomic Alignment of Consensus/Exemplar Sequence
Assembly Wormbase March 2004
Alignment(s)
Position Identity Coverage Cytoband
chrI:8283794-8296164(-) 100.0 100.0
Public Domain and Genome References
Ensembl T01G9.2
Functional Annotations
Protein Similarities
Method ID Description E-Value
blast CAB54301 Hypothetical protein T01G9.2b [Caenorhabditis elegans] ref|NP_492252.1| T01G9.2b [Caenorhabditis elegans] 0.0
blast CAB00051 Hypothetical protein T01G9.2a [Caenorhabditis elegans] ref|NP_740894.1| T01G9.2a [Caenorhabditis elegans] sp|P34692|U183_CAEEL UPF0183 protein 0.0
blast T24321 hypothetical protein T01G9.2a - Caenorhabditis elegans 0.0
blast CAA35704 hypothetical protein [Caenorhabditis elegans] 0.0
Protein Domains
Database ID Description E-Value
Pfam IPR005373 EMBL-EBI Protein of unknown function UPF0183 1.0E-126
Pfam IPR005373 EMBL-EBI Protein of unknown function UPF0183 1.0E-126
Sequence
Target Sequence
>C. ELEGANS:171721_X_AT
atgtgcaatcgattcttggagccccgacaaaggtcttctacaagtccgatgacaagatga
gaattcatcgtggacttcacaaggagacactctatggaccaccaaatttcttcttcaact
actttgtaatgggattggatattctgtttgattttgtctcgaagcgtgttgtcaaattcg
ttcttcataccaatgcaccaggacactgtgactttggaaggtactcacgatgcaactttt
caatcttcttgaatgacaagcaatacgagattcgtacggattcaaagttcgatgaattct
cgcacgccttcatgaatgactcaaatccgcctcgtccagtggttcttgctcgccaagagc
aacaaccatttggatccacattctgctacggaatcaaacaaattattgtcgaaagaaccg
agaatggattcctcacttcagtca


BLASTn GenBank NR
Probe Info
Probe Sequence(5'-3') Probe X Probe Y Probe Interrogation
Position
Strandedness
ATGTGCAATCGATTCTTGGAGCCCC 605 49 801 Antisense
AGCCCCGACAAAGGTCTTCTACAAG 696 81 820 Antisense
CAAGGAGACACTCTATGGACCACCA 9 185 880 Antisense
GGACCACCAAATTTCTTCTTCAACT 294 523 896 Antisense
GCGTGTTGTCAAATTCGTTCTTCAT 235 293 964 Antisense
GTTCTTCATACCAATGCACCAGGAC 466 443 980 Antisense
GGTACTCACGATGCAACTTTTCAAT 128 505 1020 Antisense
AAGTTCGATGAATTCTCGCACGCCT 557 155 1085 Antisense
CTCGCACGCCTTCATGAATGACTCA 523 233 1099 Antisense
CATTTGGATCCACATTCTGCTACGG 211 215 1167 Antisense
GAGAATGGATTCCTCACTTCAGTCA 452 391 1220 Antisense
Sequence Source GenBank