[Home] | [Total List]

[171720_x_at]

Description AV179929_rc /REP_DB=TREMBL Accession /GB=AV179929 /CHR=2 /FEA=Genomic Cluster /DEF=Caenorhabditis elegans cDNA clone:yk600a5 : 3prime end, single read.
Cluster 6grp_highest_10_10 > 60      6grp_high1_10_10 > 17      4grp_highest_8_8 > 08      4grp_high_8_8 > 44      6grp_highest_nonorm > 61      6grp_total > 07      4grp_total > 51      6grp_highest_sub > De      6grp_high1_sub > De      6grp_total_sub > Decrease      4grp_rule_based > L2      

Scale

Warning: fopen(./gnuplot/171720_x_at_1_Signal.dat): failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/171720_x_at_1_Signal.gnu): failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/171720_x_at_2_Signal.dat): failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/171720_x_at_2_Signal.gnu): failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 323
1 2 3 4 range
A 384.3
(-0.6)
P
520.9
(3)
P
448.4
(1.1)
P
295.6
(-3)
P
225
B 387.7
(-1.9)
P
566.1
(3)
P
468.7
(0.3)
P
347.6
(-3)
P
219
C 403.5
(1.7)
P
446.9
(3)
P
418
(2.2)
P
242.9
(-3)
P
204
avr 391.8
(-0.3)
511.3
(3)
445
(1.2)
295.4
(-3)
216

Warning: fopen(./gnuplot/171720_x_at_dSignal.dat): failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/171720_x_at_dSignal.gnu): failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 364
1 2 3 4 5 6 range
A 574.2
(3)
P
420.7
(-0.2)
P
506.4
(1.6)
P
285.5
(-3)
P
496.9
(1.4)
P
383.1
(-1)
P
289
B 587.4
(3)
P
443.5
(-0.7)
P
445.7
(-0.7)
P
413.7
(-1.5)
P
355.7
(-3)
P
381.8
(-2.3)
P
232
C 649.3
(3)
P
459.4
(-0.8)
P
416.8
(-1.6)
P
372.9
(-2.5)
P
364.3
(-2.7)
P
348.5
(-3)
P
301
avr 603.6
(3)
441.2
(-1)
456.3
(-0.6)
357.4
(-3)
405.6
(-1.8)
371.1
(-2.7)
246
No Scale

Warning: fopen(./gnuplot/171720_x_at_1_No_Signal.dat): failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/171720_x_at_1_No_Signal.gnu): failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/171720_x_at_2_No_Signal.dat): failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/171720_x_at_2_No_Signal.gnu): failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 105
1 2 3 4 range
A 139.9
(3)
P
113.1
(1.3)
P
117.2
(1.6)
P
43.3
(-3)
P
97
B 123.6
(1.5)
P
139.8
(3)
P
108.6
(0.2)
P
74.1
(-3)
P
66
C 133.6
(2.3)
P
128.5
(2)
P
145.7
(3)
P
41
(-3)
P
105
avr 132.4
(3)
127.1
(2.6)
123.8
(2.4)
52.8
(-3)
80

Warning: fopen(./gnuplot/171720_x_at_dNo_Signal.dat): failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/171720_x_at_dNo_Signal.gnu): failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 168
1 2 3 4 5 6 range
A 105.9
(-0.4)
P
149.6
(3)
P
110.3
(-0.1)
P
72.4
(-3)
P
149.9
(3)
P
93.3
(-1.4)
P
78
B 204.4
(3)
P
147.6
(-0.5)
P
108.2
(-3)
P
109.6
(-2.9)
P
144.5
(-0.7)
P
142.4
(-0.9)
P
96
C 240.7
(3)
P
140.2
(-0.6)
P
106.1
(-1.9)
P
75
(-3)
P
117.9
(-1.4)
P
116.7
(-1.5)
P
166
avr 183.7
(3)
145.8
(0.7)
108.2
(-1.6)
85.7
(-3)
137.4
(0.2)
117.5
(-1.1)
98
NetAffx Links Cluster Members
Consensus/Exemplar
Group Members
GeneChip Array Information
Probe Set ID 171720_x_at
GeneChip Array C. elegans Genome Array
Organism Common Name Nematode
Probe Design Information
Transcript ID(Array Design) affy.Ce.20641
Sequence Type Exemplar sequence
Representative Public ID AV179929 NCBI
Target Description AV179929_rc /REP_DB=TREMBL Accession /GB=AV179929 /CHR=2 /FEA=Genomic Cluster /DEF=Caenorhabditis elegans cDNA clone:yk600a5 : 3prime end, single read.
Cluster Evidence This cluster is supported by a Genomic Cluster.
Annotation Method Description
Annotation Description This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s).
Annotation Grade This is a grade A annotation.
Annotation Transcript Cluster (# of Matching Probes) NM_064443(11)
Transcript Assignments
Representative
Transcript
Description Matching Probes Related Probesets by Grade
NM_064443 NCBI Caenorhabditis elegans Y48E1B.14a (Y48E1B.14) mRNA, complete cds. 11/11 None
Y48E1B.14a.2 ENSEMBL cdna:known chromosome:CEL140:II:13522470:13531114:-1 gene:Y48E1B.14 11/11 A 
Y48E1B.14a.1 ENSEMBL cdna:known chromosome:CEL140:II:13522841:13531114:-1 gene:Y48E1B.14 11/11 A 
Y48E1B.14a.3 ENSEMBL cdna:known chromosome:CEL140:II:13522845:13531116:-1 gene:Y48E1B.14 11/11 None
Annotation Notes
Cross Hybridizing mRNA Matched Probes Nature of Assignment Related Probesets by Grade
SNAP00000024041 8/11 Cross Hyb Matching Probes None
GENEFINDER00000024042 8/11 Cross Hyb Matching Probes None
Y48E1B.14b 6/11 Cross Hyb Matching Probes None
Splice Variants
Entrez Total Refseq Isoforms Total Detected By This Probeset Refseq Probesets
174997 2 1 NM_064443 171720_x_at (11), 189745_s_at (11)
Genomic Alignment of Consensus/Exemplar Sequence
Assembly Wormbase March 2004
Alignment(s)
Position Identity Coverage Cytoband
chrII:13522907-13523189(-) 100.0 100.0
Public Domain and Genome References
Ensembl Y48E1B.14
Functional Annotations
Protein Similarities
Method ID Description E-Value
blast CAC70107 Hypothetical protein Y48E1B.14a [Caenorhabditis elegans] emb|CAD89896.1| Hypothetical protein Y48E1B.14a [Caenorhabditis elegans] ref|NP_496844.3| Y48E1B.14a [Caenorhabditis elegans] 0.0
blast CAE73334 Hypothetical protein CBG20763 [Caenorhabditis briggsae] 0.0
blast CAD59174 Hypothetical protein Y48E1B.14b [Caenorhabditis elegans] ref|NP_871950.1| Y48E1B.14b [Caenorhabditis elegans] 8.0E-72
Protein Domains
Database ID Description E-Value
Pfam IPR003114 EMBL-EBI PX-associated 1.3E-8
Pfam IPR001683 EMBL-EBI Phox-like 4.1E-15
Trans Membrane
ID Number Of Domains Domain Boundaries
NP_496844.3 1 20-42
Y48E1B.14a.2 1 20-42
Y48E1B.14a.1 1 20-42
Y48E1B.14a.3 1 20-42
Sequence
Target Sequence
>C. ELEGANS:171720_X_AT
cctaatcggccgtgacgacatcaagacactcatctcgcgcataatcgacgttctacagta
cccacggctcaacaaacagttgctctacgtgctcgtcgaccgcctcctcctacaaatttt
cccagaactcgatgaattcggccagcacccgctacaataggcccctgtaggcaggcattg
tactttgtattt


BLASTn GenBank NR
Probe Info
Probe Sequence(5'-3') Probe X Probe Y Probe Interrogation
Position
Strandedness
CCTAATCGGCCGTGACGACATCAAG 189 225 37 Antisense
ACGACATCAAGACACTCATCTCGCG 34 93 51 Antisense
CATCTCGCGCATAATCGACGTTCTA 648 211 67 Antisense
ATAATCGACGTTCTACAGTACCCAC 203 1 77 Antisense
TACCCACGGCTCAACAAACAGTTGC 192 649 95 Antisense
ACAAACAGTTGCTCTACGTGCTCGT 517 111 108 Antisense
TCCTCCTACAAATTTTCCCAGAACT 700 591 141 Antisense
GAACTCGATGAATTCGGCCAGCACC 496 349 161 Antisense
CCGCTACAATAGGCCCCTGTAGGCA 565 261 185 Antisense
ATAGGCCCCTGTAGGCAGGCATTGT 168 21 193 Antisense
TAGGCAGGCATTGTACTTTGTATTT 291 651 204 Antisense
Sequence Source Affymetrix Proprietary Database